pmid title sentence year journal region virus mutation mutation_start mutation_end gene gene_start gene_end disease disease_start disease_end 10475384 Rapid test for identification of a human papillomavirus 16 E6 L83V variant. Rapid test for identification of a human papillomavirus 16 E6 L83V variant. 1999 Diagnostic molecular pathology Title HPV L83V 62 66 E6 59 61 10917543 Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. 2000 British journal of cancer Title HPV L83V 56 60 E6 30 32 Cervical lesions 77 104 17311337 Distinctive distribution of HPV16 E6 D25E and E7 N29S intratypic Asian variants in Korean commercial sex workers. Distinctive distribution of HPV16 E6 D25E and E7 N29S intratypic Asian variants in Korean commercial sex workers. 2007 Journal of medical virology Title HPV D25E;N29S 37;49 41;53 E6;E7 34;46 36;48 18841393 HPV-16 E6 L83V variant in squamous cell carcinomas of the upper aerodigestive tract. HPV-16 E6 L83V variant in squamous cell carcinomas of the upper aerodigestive tract. 2009 Journal of cancer research and clinical oncology Title HPV L83V 10 14 E6 7 9 Squamous cell carcinoma 26 83 20572344 [The enhancement of DNA binding ability of a mutated E2 (A338V) protein of HPV-2]. [The enhancement of DNA binding ability of a mutated E2 (A338V) protein of HPV-2]. 2010 Bing du xue bao Title HPV A338V 57 62 E2 53 55 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. 2011 Virology journal Title HPV D25E;D25E 67;67 71;71 E6 64 66 26318249 The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. 2015 Virology Title HPV T350G 28 42 E6;E7 43;120 45;122 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. 2018 The Indian journal of medical research Title HPV E350G;E350G 41;41 46;46 31996427 Human Papillomavirus 58 E7 T20I/G63S Variant Isolated from an East Asian Population Possesses High Oncogenicity. Human Papillomavirus 58 E7 T20I/G63S Variant Isolated from an East Asian Population Possesses High Oncogenicity. 2020 Journal of virology Title HPV T20I;G63S 27;32 31;36 E7 24 26 8806176 The E6 variant proteins E6I-E6IV of human papillomavirus 16: expression in cell free systems and bacteria and study of their interaction with p53. The E6 variant proteins E6I-E6IV of human papillomavirus 16: expression in cell free systems and bacteria and study of their interaction with p53. 1996 Virus research Title HPV E6I 24 27 E6 4 6 10211973 Intratype sequence variation among clinical isolates of the human papillomavirus type 6 L1 ORF: clustering of mutations and identification of a frequent amino acid sequence variant. The R3 region contains predominantly non-silent substitutions, the most common of which is a G-to-C substitution at position 7079. 1999 The Journal of general virology Abstract HPV G7079C 93 129 10211973 Intratype sequence variation among clinical isolates of the human papillomavirus type 6 L1 ORF: clustering of mutations and identification of a frequent amino acid sequence variant. This results in a Glu-to-Gln change at aa 431, although this change had no effect on VLP yield or stability. 1999 The Journal of general virology Abstract HPV E431Q 18 45 10233949 Characterization of a major neutralizing epitope on human papillomavirus type 16 L1. Alteration of the amino acid at position 50, from L to F, completely restored H16.V5 binding and partially restored H16.E70 binding, while complete restoration of H16.E70 binding occurred with GU-2 VLPs containing both L50F and T266A alterations. 1999 Journal of virology Abstract HPV L50F;T266A 219;228 223;233 10233949 Characterization of a major neutralizing epitope on human papillomavirus type 16 L1. The L50F mutant of GU-2 L1, in which the H16.V5 epitope was restored, elicited HPV-16 antibody responses comparable to those obtained with 114K VLPs. 1999 Journal of virology Abstract HPV L50F 4 8 L1 24 26 10385547 Mutational and functional analysis of HPV-16 URR derived from Korean cervical neoplasia. Additionally, C-->T transition at nt 7785 (YY1-binding site 3; from 7781 to 7790) was found in 2 of 3 patients. 1999 Gynecologic oncology Abstract HPV C7785T 14 41 10385547 Mutational and functional analysis of HPV-16 URR derived from Korean cervical neoplasia. Selective mutations were observed at the YY1 binding sites of HPV-16 URR in the 3 patients with invasive cervical cancer who have the episomal forms of HPV-16 DNA: A-->C transition at nt 7484 and G-->A transition at nt 7488 (YY1-binding site 2; from 7481 to 7489). 1999 Gynecologic oncology Abstract HPV G7484A 187 201 URR 69 72 Cervical carcinoma 96 120 10389753 Uniform distribution of HPV 16 E6 and E7 variants in patients with normal histology, cervical intra-epithelial neoplasia and cervical cancer. Of all variants identified, the E6 variant 350G (L83V) and the E7 variant 822G were most frequently detected irrespective of histology and showed prevalence rates of 27% to 43% and 7% to 20%, respectively. 1999 International journal of cancer Abstract HPV L83V 49 53 E6;E7 32;63 34;65 10400710 The human papillomavirus type 16 E6 oncoprotein can down-regulate p53 activity by targeting the transcriptional coactivator CBP/p300. An HPV-16 E6 mutant (L50G) that binds CBP/p300, but not E6AP, is still capable of down-regulating p53 transcriptional activity. 1999 Journal of virology Abstract HPV L50G 21 25 E6 10 12 10475384 Rapid test for identification of a human papillomavirus 16 E6 L83V variant. A DNA sequence analysis of the PCR products revealed the conversion of Leu to Val in codon 83 of the E6 gene, correlating to the divergent band pattern. 1999 Diagnostic molecular pathology Abstract HPV L83V 71 93 E6 101 103 10475384 Rapid test for identification of a human papillomavirus 16 E6 L83V variant. The purpose of the present investigation is to describe a rapid method for the detection of this variant HPV 16, E6 (L83V). 1999 Diagnostic molecular pathology Abstract HPV L83V 117 121 E6 113 115 10475384 Rapid test for identification of a human papillomavirus 16 E6 L83V variant. This HPV 16 variant possesses a common mutation (T to G) in nucleotide 350 (codon 83) of the E6 gene, resulting in an amino acid shift, L83V, in the E6 protein. 1999 Diagnostic molecular pathology Abstract HPV L83V;T350G 136;48 140;74 E6;E6 93;149 95;151 10567656 Human papillomavirus type 16 E6 variants in cervical carcinoma: relationship to host genetic factors and clinical parameters. The most common variation detected was a T to G transition at base pair 350, resulting in an amino acid change from a leucine to a valine. 1999 The Journal of general virology Abstract HPV T350G 41 75 10639310 HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. A conformationally dependent epitope for the binding of three neutralizing monoclonal antibodies (mAbs) has been mapped to residues G(131)T(132) of the L1 major capsid protein. 2000 Virology Abstract HPV G131T 132 138 L1 152 154 10639310 HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. mAbs H11.G131S.I1 and H11.G131S.K5 bind HPV6 VLPs with the 263-290 substitutions, but show little binding to HPV6 VLPs with the 346-349 substitutions. 2000 Virology Abstract HPV G131S;G131S 9;26 14;31 10639310 HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. mAbs H11.H3 and H11.G131S.G3 bind HPV6 VLPs with substitutions derived from the 346-349 region; in addition, H11.G131S.G3 binds HPV6 VLPs with substitutions derived only from the 263-290 region. 2000 Virology Abstract HPV G131S;G131S 20;113 25;118 10639310 HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. The new mAbs are unlike the neutralizing mAbs previously mapped to residues G(131)T(132) in that they bind both prototype and HPV11:G131S mutant VLPs. 2000 Virology Abstract HPV G131T;G131S 76;132 82;137 10639310 HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. To this end, we have generated a panel of mAbs against VLPs derived from HPV11 L1 harboring a G131S substitution. 2000 Virology Abstract HPV G131S 94 99 L1 79 81 10644829 Analysis of human papillomavirus type 16 E6 variants in relation to p53 codon 72 polymorphism genotypes in cervical carcinogenesis. An initial sequence analysis of HPV-16 long control, E6 and E7 regions of 53 well-defined cervical samples containing HPV-16 revealed that a T to G transition at nucleotide position 350 within the E6 open reading frame was the most common variation, the frequency of which seemed to decrease with increasing severity of the lesion. 2000 The Journal of general virology Abstract HPV T350G 141 185 E6;E6;E7 53;197;60 55;199;62 10783118 Absence of antibody against human papillomavirus type 16 E6 and E7 in patients with cervical cancer is independent of sequence variations. All E6 antigens (the prototype and the variants 350G?L83V, 131G?R10G/350G?L83V, 335T?H78Y/350G?L83V, 345G?Y81C/350G?L83V, and African 2 ?Af2) showed cross-reactivity by RIPA. 2000 The Journal of infectious diseases Abstract HPV R10G;L83V;H78Y;L83V;Y81C;L83V;L83V 64;74;85;95;106;116;53 68;78;89;99;110;120;57 E6 4 6 10861636 Analysis of relative binding affinity of E7-pRB of human papillomavirus 16 clinical variants using the yeast two-hybrid system. A T663G/C24W polymorphic change in E7 correlated with a decrease in E7-pRb relative binding affinity the significance of which remains to be clarified. 2000 Journal of medical virology Abstract HPV T663G;C24W 2;8 7;12 E7;E7 35;68 37;70 10861636 Analysis of relative binding affinity of E7-pRB of human papillomavirus 16 clinical variants using the yeast two-hybrid system. In E7, two novel but silent polymorphic sites G663A (41.2%) and T846C (88.2%) were also prevalent in the samples analyzed. 2000 Journal of medical virology Abstract HPV G663A;T846C 46;64 51;69 E7 3 5 10861636 Analysis of relative binding affinity of E7-pRB of human papillomavirus 16 clinical variants using the yeast two-hybrid system. Particularly, a prevalent (64.7%) E6 polymorphic site A442C with an E113D amino acid substitution seems specific to Taiwanese patients. 2000 Journal of medical virology Abstract HPV A442C;E113D 54;68 59;73 E6 34 36 10880765 Enhanced oncogenicity of human papillomavirus type 16 (HPV16) variants in Japanese population. The E6 D25E, a rare variant in Western countries, was most frequently observed in ICC (44%). 2000 Cancer letters Abstract HPV D25E 7 11 E6 4 6 Cervical carcinoma 82 85 10917543 Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. Most of the malignant HPV16 variants contain a common mutation, L83V, in the E6 oncoprotein. 2000 British journal of cancer Abstract HPV L83V 64 68 E6 77 79 10917543 Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. Prototype HPV16 and its E6 variant L83V are both prevalent in preinvasive and invasive cervical lesions in Swedish women. 2000 British journal of cancer Abstract HPV L83V 35 39 E6 24 26 Cervical lesions 87 103 10917543 Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. The HPV16 E6 variant L83V was present in 40% of the HCIN lesions, in 54% of the invasive adenocarcinomas, in comparison to 81% of the invasive squamous carcinomas. 2000 British journal of cancer Abstract HPV L83V 21 25 E6 10 12 Cervical intraepithelial neoplasia;Adenocarcinoma;Squamous cell carcinoma 52;80;134 56;104;162 10917543 Uneven distribution of HPV 16 E6 prototype and variant (L83V) oncoprotein in cervical neoplastic lesions. These HPV16-positive cases were evaluated with analysis of the E6 gene, using a recently described PCR-SSCP method for identification of the specific mutation (L83V) in the E6 gene. 2000 British journal of cancer Abstract HPV L83V 160 164 E6;E6 63;173 65;175 11308254 Variation in the E2-binding domain of HPV 16 is associated with high-grade squamous intraepithelial lesions of the cervix. However, disruption of the regions of E2 analysed was significantly more frequent in high-grade lesions, and there was a significant association between the 3684C-A variant in the E2 DNA binding domain and high-grade histology suggesting that this variant may be important in progression to high-grade intraepithelial disease. 2001 British journal of cancer Abstract HPV C3684A 157 164 E2;E2 38;180 40;182 High-grade intraepithelial disease 291 325 11308254 Variation in the E2-binding domain of HPV 16 is associated with high-grade squamous intraepithelial lesions of the cervix. Isolates were also analysed for the HPV 16 350T-G variant. 2001 British journal of cancer Abstract HPV T350G 43 49 11308254 Variation in the E2-binding domain of HPV 16 is associated with high-grade squamous intraepithelial lesions of the cervix. No relationship was found between the E6 350T-G variant, or the E2 hinge region 3410C-T variant, and lesion grade. 2001 British journal of cancer Abstract HPV C3410T;T350G 80;41 87;47 E6;E2 38;64 40;66 11336560 Induction of type-specific neutralizing antibodies by capsomeres of human papillomavirus type 33. Capsomeres were obtained free of capsids by expression of L1 carrying the single point mutation C427S. 2001 Virology Abstract HPV C427S 96 101 L1 58 60 11543887 Determination of the binding affinity of different human papillomavirus E7 proteins for the tumour suppressor pRb by a plate-binding assay. Point mutation C24G in the high affinity pRb-binding domain of HPV16 E7 results in a 3-fold affinity reduction. 2001 Journal of virological methods Abstract HPV C24G 15 19 E7 69 71 11745467 Human papillomavirus 16 E6 polymorphisms in cervical lesions from different European populations and their correlation with human leukocyte antigen class II haplotypes. For instance, the HPV16-E6 L83V variant, which has been found to be positively associated with ICC in Swedish women (p = 0.002), was more prevalent in LCIN than in ICC in Italian and Czech women (p = 0.01 and = 0.03, respectively). 2001 International journal of cancer Abstract HPV L83V 27 31 E6 24 26 Cervical carcinoma;Cervical carcinoma;Cervical intraepithelial neoplasia 95;164;151 98;167;155 11745467 Human papillomavirus 16 E6 polymorphisms in cervical lesions from different European populations and their correlation with human leukocyte antigen class II haplotypes. Indeed, the DR04-DQ03 haplotype, which is approximately 3-fold more abundant in the normal Swedish population than in those in Italy and the Czech Republic, was found to be positively associated with HPV16-E6 L83V in the 3 cohorts investigated (p = 0.01). 2001 International journal of cancer Abstract HPV L83V 209 213 E6 206 208 11745467 Human papillomavirus 16 E6 polymorphisms in cervical lesions from different European populations and their correlation with human leukocyte antigen class II haplotypes. These data indicate that host genetic factors, such as HLA polymorphism, may determine the potential oncogenicity of the HPV16-E6 L83V variant. 2001 International journal of cancer Abstract HPV L83V 130 134 E6 127 129 11745467 Human papillomavirus 16 E6 polymorphisms in cervical lesions from different European populations and their correlation with human leukocyte antigen class II haplotypes. This observation may explain why L83V is a risk factor more in Sweden than in the other 2 countries. 2001 International journal of cancer Abstract HPV L83V 33 37 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. In addition, we found a specific European E6 variant, L83V, to be enriched in high-grade lesions and cancer rather than a specific European long control region variant. 2002 British journal of cancer Abstract HPV L83V 54 58 E6 42 44 12036950 Human papillomavirus E6-induced degradation of E6TP1 is mediated by E6AP ubiquitin ligase. Additionally, the expression of a dominant-negative E6AP mutant (C833A) in cells inhibited the E6-induced degradation of E6TP1. 2002 Cancer research Abstract HPV C833A 65 70 E6 95 97 12050680 [Causal association between human papilloma virus infection and head and neck and esophageal squamous cell carcinoma]. DNA was extracted from 150 fresh or paraffin embedded biopsy specimens, and analyzed for HPV by PCR with 15 sets of consensus primers directed to conserved regions of L1 gene, three sets of HPV16E6 primers (specific for the HPV 16 prototype and L83V variant), and sets of primers specific for the E6 gene of other mucosa type HPVs including HPV 6, 11, 16, 18, 52, 58, 66 and 73. 2002 Magyar onkologia Abstract HPV L83V 245 249 E6;E6;L1 297;195;167 299;197;169 12050680 [Causal association between human papilloma virus infection and head and neck and esophageal squamous cell carcinoma]. HPV16E6 T350G mutant were observed only in two of eight carcinomas. 2002 Magyar onkologia Abstract HPV T350G 8 13 E6 5 7 12189229 Association of human papillomavirus type 58 variant with the risk of cervical cancer. Among HPV58-positive women, the occurrence of E7 632C-->T (T20I) and E7 760G-->A (G63S) variants (T20I/G63S) showed a positive trend of association with the severity of neoplasia (P(trend)<.001, chi(2) test for trend). 2002 Journal of the National Cancer Institute Abstract HPV T20I;T20I;C632T;G760A;G63S;G63S;G63S 59;98;49;72;82;103;103 63;102;57;80;86;107;108 E7;E7 46;69 48;71 12189229 Association of human papillomavirus type 58 variant with the risk of cervical cancer. Patients with CIN III or ICC who were also infected with T20I/G63S variants had a statistically significant younger age at diagnosis than those infected with other variants (median age = 37 years versus 48 years; P =.038, two-sided Mann-Whitney U test). 2002 Journal of the National Cancer Institute Abstract HPV T20I;G63S 57;62 61;66 Cervical intraepithelial neoplasia;Cervical carcinoma 14;25 21;28 12189229 Association of human papillomavirus type 58 variant with the risk of cervical cancer. Thus, HPV58 variants carrying E7 T20I/G63S substitutions may be associated with an increased risk for cervical cancer. 2002 Journal of the National Cancer Institute Abstract HPV T20I;G63S 33;38 37;42 E7 30 32 Cervical carcinoma 102 117 12195358 Human papillomavirus type 16 intratypic variant infection and risk for cervical neoplasia in southern China. The E7 N29S substitution, reported to have a higher risk in Korean women, was found equally distributed among normal and various degrees of neoplasia. 2002 The Journal of infectious diseases Abstract HPV N29S 7 11 E7 4 6 12195358 Human papillomavirus type 16 intratypic variant infection and risk for cervical neoplasia in southern China. Two novel substitutions at E6 (T86I and Q116E) and 1 at E7 (R66W) were found. 2002 The Journal of infectious diseases Abstract HPV T86I;Q116E;R66W 31;40;60 35;45;64 E6;E7 27;56 29;58 12414922 Amino acid residues in the carboxy-terminal region of cottontail rabbit papillomavirus E6 influence spontaneous regression of cutaneous papillomas. In addition, a single amino acid change (G252E) in the E6 protein of the CRPV progressor strain led to high frequencies of spontaneous regressions in inbred rabbits. 2002 Journal of virology Abstract HPV G252E 41 46 E6 55 57 12438630 A mutant of human papillomavirus type 16 E6 deficient in binding alpha-helix partners displays reduced oncogenic potential in vivo. Unlike mice expressing the wild-type E6 (strain K14E6(WT)), the mice expressing E6(I128T) lacked the ability to alter the radiation-induced block to DNA synthesis and promote the formation of benign skin tumors in conjunction with chemical carcinogens. 2002 Journal of virology Abstract HPV I128T 83 88 E6;E6 37;80 39;82 Skin tumor 199 210 12438630 A mutant of human papillomavirus type 16 E6 deficient in binding alpha-helix partners displays reduced oncogenic potential in vivo. We generated transgenic mice expressing a mutant of E6, E6(I128T), which is defective for binding at least a subset of the alpha-helix partners, including E6AP, the ubiquitin ligase that mediates E6-dependent degradation of the p53 protein, to determine whether binding of alpha-helix partners plays a role in E6-mediated activities in vivo. 2002 Journal of virology Abstract HPV I128T 59 64 E6;E6;E6;E6 52;56;196;310 54;58;198;312 12551970 Nuclear entry of high-risk human papillomavirus type 16 E6 oncoprotein occurs via several pathways. Significantly, an E6(R124G) mutant had reduced nuclear import activity, and the E6 deletion mutant lacking (121)KKQR(124) was not imported into the nucleus. 2003 Journal of virology Abstract HPV R124G 21 26 E6;E6 18;80 20;82 12565157 DNA replicative functions of highly-expressed, codon-optimized human papillomavirus proteins E1 and E2. In contrast, however, an HPV 16 E2 mutant bearing an E39A substitution, reported previously to be severely compromised for DNA replication, was found to be reduced only two-fold in activity and, therefore, considered not sufficiently inactivated for use in vaccines that depend on endogenous protein expression. 2003 Journal of virological methods Abstract HPV E39A 53 57 E2 32 34 12565157 DNA replicative functions of highly-expressed, codon-optimized human papillomavirus proteins E1 and E2. Under the assay conditions, the HPV 16 E1 mutant (W439R, G482D) did not support HPV origin-driven DNA synthesis. 2003 Journal of virological methods Abstract HPV W439R;G482D 50;57 55;62 E1 39 41 12601763 Human papillomavirus type-16 variants in Quechua aboriginals from Argentina. We identified a new variant, the Argentine Quechua-51 (AQ-51), similar to B-14 plus two additional changes: G7842-->A and A7837-->C; phylogenetic inference allocated it in the Asian-American branch. 2003 Journal of medical virology Abstract HPV G7842A;A7837C 108;122 117;131 12691704 Association between human papillomavirus 16 E6 variants and human leukocyte antigen class I polymorphism in cervical cancer of Swedish women. Women with HLA-B*44, HLA-B*51, or HLA-B*57 who were infected with the HPV16 E6 variant L83V had an approximately four- to fivefold increased risk for cancer compared with controls (odds ratio [OR] = 3.5, 95% CI = 1.1-11.1, OR = 4.2, 95% CI = 1.19-14.69, or OR = 4.67, 95% CI = 1.2-18.6, respectively). 2003 Human immunology Abstract HPV L83V 87 91 E6 76 78 12706096 Mutational analysis of human papillomavirus type 16 major capsid protein L1: the cysteines affecting the intermolecular bonding and structure of L1-capsids. In the nonreducing SDS gel, where WT-capsids were separated into two bands of L1-trimers and L1-dimers, the C175S-trimer band was not detected, the C185S-dimer band was much less dense, and the C428S-trimer and C428S-dimer bands were not detected. 2003 Virology Abstract HPV C175S;C185S;C428S;C428S 108;148;194;211 113;153;199;216 L1;L1 78;93 80;95 12706096 Mutational analysis of human papillomavirus type 16 major capsid protein L1: the cysteines affecting the intermolecular bonding and structure of L1-capsids. Morphologically, the C175S, C185S, and C428S fractions appeared to consist mostly of heterogeneous rod-shaped tubules, of smaller spherical particles, and of only capsomeres, respectively, whereas C102S, C229S, and C379S resembled WT. 2003 Virology Abstract HPV C175S;C185S;C428S;C102S;C229S;C379S 21;28;39;197;204;215 26;33;44;202;209;220 12706096 Mutational analysis of human papillomavirus type 16 major capsid protein L1: the cysteines affecting the intermolecular bonding and structure of L1-capsids. Mutants C175S (C at aa 175 was replaced with S) and C185S were sedimented in sucrose-density gradients slightly slower than the wild type (WT) capsids, and mutant C428S stayed near the top as WT-capsomeres did. 2003 Virology Abstract HPV C175S;C185S;C428S 8;52;163 13;57;168 12706096 Mutational analysis of human papillomavirus type 16 major capsid protein L1: the cysteines affecting the intermolecular bonding and structure of L1-capsids. The C161S, C175S, C185S, C229S, C379S, and C428S capsids were more sensitive to degradation caused by trypsin than WT. 2003 Virology Abstract HPV C161S;C175S;C185S;C229S;C379S;C428S 4;11;18;25;32;43 9;16;23;30;37;48 12730224 Inhibition of human papillomavirus DNA replication by small molecule antagonists of the E1-E2 protein interaction. Functional evidence that the transactivation domain is the target of inhibition was obtained by swapping this domain between a sensitive (HPV11) and a resistant (cottontail rabbit papillomavirus) E2 type and by identifying an amino acid substitution, E100A, that increases inhibition by approximately 10-fold. 2003 The Journal of biological chemistry Abstract HPV E100A 251 256 E2 196 198 12820481 Co-mutation of HPV16 E6 and E7 genes in Thai squamous cervical carcinomas. A mutation from T to G at nucleotide 178, leading to a change from aspartate to glutamate (D25E), was the most common variation accounting for 70%. 2003 Anticancer research Abstract HPV T178G;D25E 16;91 40;95 12820481 Co-mutation of HPV16 E6 and E7 genes in Thai squamous cervical carcinomas. Interestingly, 90% of these E6 (D25E) variants coincided with a specific type of E7 mutation, N29S. 2003 Anticancer research Abstract HPV D25E;N29S 32;94 36;98 E6;E7 28;81 30;83 12820481 Co-mutation of HPV16 E6 and E7 genes in Thai squamous cervical carcinomas. This is the first finding of coordinated change between E6 (D25E) and E7 (N29S) in HPV, which might indicate a specific variant for the Thai population. 2003 Anticancer research Abstract HPV D25E;N29S 60;74 64;78 E6;E7 56;70 58;72 12918070 Human papillomavirus type 16 E6 variants and HLA class II alleles among Japanese women with cervical cancer. Additionally, DRB1*1502 was positively associated with a particular E6 variant designated D25E (n = 25), although we could not find a significant association between HLA class II alleles and L83V variants (n = 16). 2003 International journal of cancer Abstract HPV D25E;L83V 90;191 94;195 E6 68 70 1321216 Geographical dependence of sequence variation in the E7 gene of human papillomavirus type 16. One tumour harbours HPV-16 DNA with a mutation (C to T) at nucleotide 790 changing the E7 amino acid sequence (arginine to cysteine) at position 76. 1992 The Journal of general virology Abstract HPV C790T;R76C 47;110 73;147 E7 87 89 14625386 Activity of the human papillomavirus E6 PDZ-binding motif correlates with an enhanced morphological transformation of immortalized human keratinocytes. Changes to the epithelial phenotype of cells expressing a mutant E6 protein (Thr156Glu) that is unable to degrade discs large was significantly less marked, although they did show evidence of epithelial-mesenchymal transition. 2003 Journal of cell science Abstract HPV T156E 77 86 E6 65 67 14625386 Activity of the human papillomavirus E6 PDZ-binding motif correlates with an enhanced morphological transformation of immortalized human keratinocytes. The altered phenotype was accentuated in cells expressing an E6 protein containing a mutation (Arg153Leu) within a protein kinase A recognition motif that abrogates protein kinase A's negative regulation of the activity of the PDZ-binding domain. 2003 Journal of cell science Abstract HPV R153L 95 104 E6 61 63 15006625 Human papillomavirus type 16 E6 and E7 genotypes in head-and-neck carcinomas. Sequence analysis of the E6-E7 segments revealed three different HPV16 E6-E7 genotypes: the HPV16 prototype (6 of 21 cases), the E6 variant T350G (8 of 21 cases), and the E6-E7 variant A131G/C712A (7 of 21 cases). 2004 Oral oncology Abstract HPV T350G;A131G;C712A 140;185;191 145;190;196 E6;E7;E6;E7;E6;E6;E7 25;28;71;74;129;171;174 27;30;73;76;131;173;176 15006625 Human papillomavirus type 16 E6 and E7 genotypes in head-and-neck carcinomas. The E6 variants T350G and A131G have been associated with increased oncogenic potential in cervical cancer patients depending on host genetic factors. 2004 Oral oncology Abstract HPV T350G;A131G 16;26 21;31 E6 4 6 Cervical carcinoma 91 106 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Of seven HPV-16 E7 mutants analysed (H2P, Delta6-10, Delta21-24, C24G, S31G/S32G, A50S and S71I), five were severely impaired in their ability to induce tetrasomy in monolayer and raft culture. 2004 British journal of cancer Abstract HPV H2P;S31G;C24G;S32G;A50S;S71I 37;71;65;76;82;91 40;75;69;80;86;95 E7 16 18 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Only mutant C24G induced tetrasomy to levels comparable with wild-type E7 in monolayer and raft culture. 2004 British journal of cancer Abstract HPV C24G 12 16 E7 71 73 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The casein kinase II phosphorylation defective mutant S31G/S32G induced tetrasomy to levels comparable with wild-type E7 in raft culture, but not in monolayer culture, and induction of tetrasomy did not correlate with raft morphology. 2004 British journal of cancer Abstract HPV S31G;S32G 54;59 58;63 E7 118 120 15297193 Human papillomavirus type 16 E6, E7, and L1 variants in cervical cancer in Indonesia, Suriname, and The Netherlands. RESULTS: A specific Javanese variant, with mutations 666A in E7 and 6826T in L1, was found in 73% of the Indonesian samples, 56% having an additional mutation in the E6 open reading frame (ORF; 276G), giving the predicted amino acid change N58S. 2004 Gynecologic oncology Abstract HPV N58S 240 244 E7;E6;L1 61;166;77 63;168;79 15363193 [Analysis of human papillomavirus 16 E6 oncogene mutation in Xinjiang Uygur women with cervical carcinoma]. RESULTS: The result of PCR showed that the positive rate of HPV16E6 was 82.86%(29/35); 26 of these 29 PCR fragments were sequenced and analyzed, 15 of them maintained prototype (57.69%), 11 have L83V mutation (34.62%), and 2 have L83V/D63E mutation (7.69%). 2004 Ai zheng Abstract HPV L83V;L83V;D63E 195;230;235 199;234;239 E6 60 67 15491758 E2 sequence variations of HPV 16 among patients with cervical neoplasia seen in the Indian subcontinent. Samples with digestion profiles III and IV revealed three variations in the hinge region (3516 C-A, 3538 A-C, 3566 T-G) and two in the DNA binding domain (3684 C-A, 3694 T-A) of the E2 sequence. 2004 Gynecologic oncology Abstract HPV C3516A;A3538C;T3566G;C3684A;T3694A 90;100;110;155;165 98;108;118;163;173 E2 182 184 15572004 The prevalence of HPV-18 and variants of E6 gene isolated from cervical cancer patients in Taiwan. The identified HPV-18 E6 variants had a unique silence mutation located on C183G in E6 coding region. 2005 Journal of clinical virology Abstract HPV C183G 75 80 E6;E6 22;84 24;86 15572004 The prevalence of HPV-18 and variants of E6 gene isolated from cervical cancer patients in Taiwan. The most dominant mutation among 25 tested patients was a silence mutation C183G of the E6 coding region. 2005 Journal of clinical virology Abstract HPV C183G 75 80 E6 88 90 15670304 Polymorphism in the E6 gene of human papillomavirus type 16 in the cervical tissues of Korean women. No significance difference was found between the frequencies of D25E variation in cancerous and non-cancerous lesions. 2005 International journal of gynecological cancer Abstract HPV D25E 64 68 15670304 Polymorphism in the E6 gene of human papillomavirus type 16 in the cervical tissues of Korean women. The most frequently found variation was D25E (in NCD, n = 8, 80%; in CIN, n = 9, 52.9%; in ICC, n = 23, 85.2%). 2005 International journal of gynecological cancer Abstract HPV D25E 40 44 Cervical intraepithelial neoplasia;Cervical carcinoma 69;91 72;94 15721413 Human papillomavirus type 16 E2 and E6/E7 variants. RESULTS: In the 100 samples analyzed, only one new polymorphism was identified, a synonymous change, T3205A, in region E2. 2005 Gynecologic oncology Abstract HPV T3205A 101 107 E2 119 121 15721413 Human papillomavirus type 16 E2 and E6/E7 variants. The frequency distribution of variants in the sample set was 37 European prototypes and 27 E-G350, 16 AA, 5 Af1, 2 Af2, 8 E-C109G, 3 E-G131G, and 2 As. 2005 Gynecologic oncology Abstract HPV E-G350;C109G;G131G 91;122;133 97;129;140 15767402 Human papillomavirus type 16 E1 E4-induced G2 arrest is associated with cytoplasmic retention of active Cdk1/cyclin B1 complexes. A mutant 16E1 E4 (T22A, T23A) which does not bind cyclin B1 or alter its intracellular location fails to induce G2 arrest. 2005 Journal of virology Abstract HPV T22A;T23A 18;24 22;28 E4 14 16 15929080 Interaction of host and viral risk factors for development of cervical carcinoma in situ. However, an association was found between the HPV 16 E6 L83V variant and the DR*04-DQ*03 haplotype. 2005 International journal of cancer Abstract HPV L83V 56 60 E6 53 55 16012730 Sequence variation and the transcriptional activity of the upstream regulatory region in human papillomavirus 16 E7 variants in cervical cancer of Korean women. The other sequence variations, which were matched with the TFBS, were A7485C, G7489A, T7743G and G7842A. 2005 Oncology reports Abstract HPV A7485C;G7489A;T7743G;G7842A 70;78;86;97 76;84;92;103 16012730 Sequence variation and the transcriptional activity of the upstream regulatory region in human papillomavirus 16 E7 variants in cervical cancer of Korean women. The sequence variations T7781C and C7786T were matched with YY1 binding sites, G7193T and C7689A were matched with TEF1 binding sites, and C7394T and C7395T were matched with GRE binding sites. 2005 Oncology reports Abstract HPV T7781C;C7786T;G7193T;C7689A;C7394T;C7395T 24;35;79;90;139;150 30;41;85;96;145;156 16012730 Sequence variation and the transcriptional activity of the upstream regulatory region in human papillomavirus 16 E7 variants in cervical cancer of Korean women. Using PCR-directed sequencing, the presence of sequence variations in URRs were analyzed and the sites of sequence variation were matched with the known transcriptional factor binding site (TFBS) in 26 HPV 16 E7 variants, 21 cases with A647G (KE7-1, high oncogenic potential) and 5 cases with T732C (KE7-2, low oncogenic potential). 2005 Oncology reports Abstract HPV A647G;T732C 236;293 241;298 URR;E7 70;209 74;211 16099904 Differential splicing of E6 within human papillomavirus type 18 variants and functional consequences. Mutagenesis analysis of the reference clone showed that a C491A change reverts the phenotype. 2005 The Journal of general virology Abstract HPV C491A 58 63 16175337 Human papillomavirus 16 minor capsid protein L2 helps capsomeres assemble independently of intercapsomeric disulfide bonding. Similar particles were obtained from the Sf9 cells co-infected with baculoviruses expressing L2 and an L1 mutant that lacks a C-terminal cysteine (C428S) and can form capsomeres but no capsids when expressed alone. 2005 Virus genes Abstract HPV C428S 147 152 L1;L2 103;93 105;95 16333213 [Investigation of human papillomavirus, its types and variants]. HPV 16 (55.8% in squamous cell carcinoma patients and 35.3% in cervical adenocarcinoma patients) and its European HPV 16 L83V variant were detected more frequently in cervical cancer patients. 2005 Medicina (Kaunas, Lithuania) Abstract HPV L83V 121 125 Squamous cell carcinoma;Adenocarcinoma;Cervical carcinoma 17;63;167 40;86;182 16350393 Identification of HPV variants. In particular, we describe methods for the identification of variation within the HPV-16 E5 open reading frame and for the detection of the nt 131 A-->G mutation of the E6 ORF, using restriction fragment length polymorphism assays. 2005 Methods in molecular medicine Abstract HPV A131G 143 152 E5;E6 89;169 91;171 16519914 HPV16 E6 natural variants exhibit different activities in functional assays relevant to the carcinogenic potential of E6. On the other hand, L83V displayed more efficient degradation of Bax and binding to E6BP, but lower binding to hDlg. 2006 Virology Abstract HPV L83V 19 23 16519914 HPV16 E6 natural variants exhibit different activities in functional assays relevant to the carcinogenic potential of E6. The L83V polymorphism, previously associated with risk for cancer progression in some populations, expressed similar levels of activity as that of the E6 prototype in most functional assays. 2006 Virology Abstract HPV L83V 4 8 E6 151 153 16603519 Analysis of mutations in the E6/E7 oncogenes and L1 gene of human papillomavirus 16 cervical cancer isolates from China. In addition to D25E and E113D, the following E6 variations were found in this study: R129K, E89Q, S138C, H78Y, L83V and F69L. 2006 The Journal of general virology Abstract HPV D25E;R129K;E89Q;S138C;H78Y;L83V;F69L;E113D 15;85;92;98;105;111;120;24 19;90;96;103;109;115;124;29 E6 45 47 16603519 Analysis of mutations in the E6/E7 oncogenes and L1 gene of human papillomavirus 16 cervical cancer isolates from China. Prevalences of HPV16 E6 D25E and E113D variants were 67.3 and 9 %, respectively. 2006 The Journal of general virology Abstract HPV D25E;E113D 24;33 28;38 E6 21 23 16603519 Analysis of mutations in the E6/E7 oncogenes and L1 gene of human papillomavirus 16 cervical cancer isolates from China. The following L1 variations were found in this study: S377A, K387E, E378D, K382E and T379P. 2006 The Journal of general virology Abstract HPV S377A;K387E;E378D;K382E;T379P 54;61;68;75;85 59;66;73;80;90 L1 14 16 16603519 Analysis of mutations in the E6/E7 oncogenes and L1 gene of human papillomavirus 16 cervical cancer isolates from China. The results also showed that the prevalences of three hot spots of E7 nucleotide variation, N29S, S63F and a silent variation, nt T846C, were 70.2 % (33/47), 51.1 % (24/47) and 61.7 % (29/47), respectively. 2006 The Journal of general virology Abstract HPV N29S;S63F;T846C 92;98;130 96;102;135 E7 67 69 16786144 Detection and expression of human papillomavirus oncogenes in non-small cell lung cancer. Sequencing of the entire E6 and E7 genes of HPV16 showed a T to G transition at nucleotide position 350 of E6, in all examined cases. 2006 Oncology reports Abstract HPV T350G 59 103 E6;E6;E7 25;107;32 27;109;34 16800784 The human papillomavirus type 16 E7 protein binds human interferon regulatory factor-9 via a novel PEST domain required for transformation. Finally, we used alanine-scanning mutagenesis to determine if E7-IRF-9 interaction was important for E7-mediated cellular transformation and found that the HPV-16 E7 mutants Y25A, E26A, S31A, S32A, and E35A, but not L28A and N29A, caused loss of transformation ability. 2006 Journal of interferon & cytokine research Abstract HPV Y25A;E26A;S32A;E35A;L28A;N29A;S31A 174;180;192;202;216;225;186 178;184;196;206;220;229;190 E7;E7;E7 62;101;163 64;103;165 16938363 A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. Binding of Mab H16:E70 to A266T was reduced by almost half in comparison to wild type L1. 2006 Virus research Abstract HPV A266T 26 31 L1 86 88 16938363 A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. Retention of the C-terminal region 428-483 was critical for the binding of conformation-specific Mabs (H16:V5, H16:E70, H16:U4 and H16:9A) whereas deletion of the nuclear localisation signal (NLS) or the C428G mutation or an N-terminal deletion (residues 2-9) did not affect the antigenicity. 2006 Virus research Abstract HPV C428G 204 209 16938363 A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. The N-terminal deletion resulted in a mixed population of 30 and 55nm VLPs, which differs from the same construct expressed in Escherichia coli, whereas pentamer aggregates resulted from deletion of the 428-465 region or the C428G mutation. 2006 Virus research Abstract HPV C428G 225 230 16938363 A deletion and point mutation study of the human papillomavirus type 16 major capsid gene. This paper analyses, using a panel of well-characterised Mabs, the effects on the antigenicity of various C- and N-terminal deletants of HPV-16 L1 made in insect cells via recombinant baculovirus, of an A-->T mutation at residue 266 (A266T), and of a C-->G mutation at conserved position 428 (C428G). 2006 Virus research Abstract HPV A266T;C428G;A266T 234;293;203 239;298;232 L1 144 146 16960775 Human papillomavirus type 33 polymorphisms and high-grade squamous intraepithelial lesions of the uterine cervix. The C7732G variation, which results in the loss of a putative binding site for the cellular upstream stimulatory factor, was associated with HSILs (age- and site-adjusted OR, 8.0 [95% CI, 1.5-42.8]). 2006 The Journal of infectious diseases Abstract HPV C7732G 4 10 Squamous intraepithelial lesions 141 146 16960775 Human papillomavirus type 33 polymorphisms and high-grade squamous intraepithelial lesions of the uterine cervix. The HPV-33 MT 1-0-0 variant carrying the G7584A variation was detected more frequently in women from Brazil (7/20 [35%]) than in women from Canada (1/65 [1.5%]; P=.001). 2006 The Journal of infectious diseases Abstract HPV G7584A 41 47 17192187 Human papillomavirus typing of invasive cervical cancers in Italy. Of the 32 HPV 16 positive cases, sequencing of the E6 gene could be performed in 25; the prototype isolate was identified in 7, and the variant T350G in 18; in 4 cases one or more additional mutations were present. 2006 Infectious agents and cancer Abstract HPV T350G 144 149 E6 51 53 17311337 Distinctive distribution of HPV16 E6 D25E and E7 N29S intratypic Asian variants in Korean commercial sex workers. Although this study has some limitations such as a small sample size and not enough clinical data, these finding suggests that the distinctive distribution of HPV 16 As-variant E6 D25E and E7 N29S might be associated with geographical dependence rather than disease progression. 2007 Journal of medical virology Abstract HPV D25E;N29S 180;192 184;196 E6;E7 177;189 179;191 17311337 Distinctive distribution of HPV16 E6 D25E and E7 N29S intratypic Asian variants in Korean commercial sex workers. At the amino acid level, the isolates showed 14 variants including E6 Q14H, E6 D25E, E6 I27R, E6 H78Y, E6 L83V, and E7 N29S. 2007 Journal of medical virology Abstract HPV Q14H;D25E;I27R;H78Y;L83V;N29S 70;79;88;97;106;119 74;83;92;101;110;123 E6;E6;E6;E6;E6;E7 67;76;85;94;103;116 69;78;87;96;105;118 17311337 Distinctive distribution of HPV16 E6 D25E and E7 N29S intratypic Asian variants in Korean commercial sex workers. The dominant HPV16 E6 and E7 variants were HPV16 E6 D25E (68%) and HPV16 E7 N29S (73%), respectively, which belong to Asian lineage. 2007 Journal of medical virology Abstract HPV D25E;N29S 52;76 56;80 E6;E7;E6;E7 19;26;49;73 21;28;51;75 17429529 [Association between human papillomavirus (HPV) type 16 infection and E6/E7 gene variant and the cervical lesions in Beijing]. A mutation, E6-D32E (T96G) coincided with a specific type of E7 mutation, N29S (A86G). 2007 Zhonghua shi yan he lin chuang bing du xue za zhi Abstract HPV D32E;T96G;N29S;A86G 15;21;74;80 19;25;78;84 E6;E7 12;61 14;63 17429529 [Association between human papillomavirus (HPV) type 16 infection and E6/E7 gene variant and the cervical lesions in Beijing]. CONCLUSION: HPV 16 was the most common type in women with cervical lesions in Beijing, D32E/N29S variant associated with the cervical lesions. 2007 Zhonghua shi yan he lin chuang bing du xue za zhi Abstract HPV D32E;N29S 87;92 91;96 Cervical lesions;Cervical lesions 58;125 74;141 17429529 [Association between human papillomavirus (HPV) type 16 infection and E6/E7 gene variant and the cervical lesions in Beijing]. D32E/N29S mutation rate was 38.9% (28/72), the detection rate increased with the severity of cervical lesions (P < 0.05). 2007 Zhonghua shi yan he lin chuang bing du xue za zhi Abstract HPV D32E;N29S 0;5 4;9 Cervical lesions 93 109 17854024 Activities of human papillomavirus 16 E6 natural variants in human keratinocytes. The I27R/L83V variant showed the lowest activity whereas the R8Q variant showed the highest activity. 2007 Journal of medical virology Abstract HPV R8Q;I27R;L83V 61;4;9 64;8;13 17854024 Activities of human papillomavirus 16 E6 natural variants in human keratinocytes. The L83V polymorphism previously associated with risk for cancer progression in some populations, showed significant activity, comparable to that of the E6 prototype, in reducing p53 and Bax levels. 2007 Journal of medical virology Abstract HPV L83V 4 8 E6 153 155 17854024 Activities of human papillomavirus 16 E6 natural variants in human keratinocytes. This, and augmentation of other described functions might result in differences in L83V pathogenicity. 2007 Journal of medical virology Abstract HPV L83V 83 87 17877642 An oligoarray for the detection of human papillomavirus type 16 variants. We applied a sensitive and specific stacking hybridization assay using an oligoarray for the detection of Asian-American (AA) and European (E) (E350G) HPV 16 variants. 2007 International journal of gynecological cancer Abstract HPV E350G 144 149 17962940 Mutation in the immunodominant epitope of the HPV16 E7 oncoprotein as a mechanism of tumor escape. We have found immunoresistance of the clones to correlate with the point mutation in the E7 oncogene, which resulted in the N53S substitution in the immunodominant epitope RAHYNIVTF (aa 49-57). 2008 Cancer immunology, immunotherapy Abstract HPV N53S 124 128 E7 89 91 18199779 Human papillomavirus type 16 variant analysis of E6, E7, and L1 genes and long control region in biopsy samples from cervical cancer patients in north India. In addition, only one novel variant (T527A) in E6 and four new variants each in L1 (A6667C, A6691G, C6906T, and A6924C) and in the LCR (C13T, A7636C, C7678T, and G7799A) were identified. 2008 Journal of clinical microbiology Abstract HPV T527A;A6667C;A6691G;C6906T;A6924C;C13T;A7636C;C7678T;G7799A 37;84;92;100;112;136;142;150;162 42;90;98;106;118;140;148;156;168 E6;L1;LCR 47;80;131 49;82;134 18199779 Human papillomavirus type 16 variant analysis of E6, E7, and L1 genes and long control region in biopsy samples from cervical cancer patients in north India. The most frequently observed variations were T350G (100%) in E6, T789C (87.5%) in E7, A6695C (54.5%) in L1, and G7521A (91.1%) in the LCR. 2008 Journal of clinical microbiology Abstract HPV T350G;T789C;A6695C;G7521A 45;65;86;112 50;70;92;118 E6;E7;L1;LCR 61;82;104;134 63;84;106;137 18512138 A non-radioactive PCR-SSCP analysis allows to distinguish between HPV 16 European and Asian-American variants in squamous cell carcinomas of the uterine cervix in Colombia. A nucleotide transition (G to A) at position 7521 was the most prevalent variation (80%) found in the enhancer sequence of the LCR region. 2008 Virus genes Abstract HPV G7521A 24 49 LCR 127 130 18512138 A non-radioactive PCR-SSCP analysis allows to distinguish between HPV 16 European and Asian-American variants in squamous cell carcinomas of the uterine cervix in Colombia. HPV 16 was detected in 57.6% of the tumors. The European branch was identified in 88.2% of the samples with the E-G350 class being the most prevalent variant (41.1%). 2008 Virus genes Abstract HPV E-G350 112 118 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Mapping studies identified lysine 292 as the principal residue for covalent conjugation of SUMO to HPV16 E2, and a lysine 292 to arginine mutant showed defects for both transcriptional activation and repression. 2008 Virology Abstract HPV K292R 115 137 E2 105 107 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). The expression levels, intracellular localization, and the DNA-binding activity of HPV16 E2 were unchanged by this K292R mutation, suggesting that the transcriptional defect reflects a functional contribution by sumoylation at this residue. 2008 Virology Abstract HPV K292R 115 120 E2 89 91 18632869 Identification of an arginine-rich motif in human papillomavirus type 1 E1;E4 protein necessary for E4-mediated inhibition of cellular DNA synthesis in vitro and in cells. HPV1 E4-mediated replication inhibition in vitro and suppression of entry of HPV1 E4-expressing cells into S phase are both abrogated upon alanine replacement of arginine 45 in the full-length E4 protein (E1;E4), implying that these two HPV1 E4 functions are linked. 2008 Journal of virology Abstract HPV R45A 139 173 E1;E4;E4;E4;E4;E4 205;5;82;193;208;242 207;7;84;195;210;244 18649911 Human papillomavirus type 45 E7 is a transforming protein inducing retinoblastoma protein degradation and anchorage-independent cell cycle progression. HPV-45 E7C28G did not bind pRb and could neither induce pRb-proteolysis nor promote cell cycle progression. 2008 Virology Abstract HPV C28G 9 13 E7 7 9 18649911 Human papillomavirus type 45 E7 is a transforming protein inducing retinoblastoma protein degradation and anchorage-independent cell cycle progression. We demonstrate here that the HPV-45 E7 protein transforms immortalized NIH3T3 fibroblasts, while mutations in either the conserved LXCXE sequence (C28G) or the carboxyl-terminus (Delta87LQQLF91) significantly abolish this activity. 2008 Virology Abstract HPV C28G 147 151 E7 36 38 18841393 HPV-16 E6 L83V variant in squamous cell carcinomas of the upper aerodigestive tract. The HPV-16 E6 L83V variant was present in five cases. 2009 Journal of cancer research and clinical oncology Abstract HPV L83V 14 18 E6 11 13 18841393 HPV-16 E6 L83V variant in squamous cell carcinomas of the upper aerodigestive tract. The potential prognostic significance of HPV-16 E6 L83V variant in HPV-16 positive UADT-SCCs should be more extensively investigated. 2009 Journal of cancer research and clinical oncology Abstract HPV L83V 51 55 E6 48 50 Squamous cell carcinoma 88 92 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. In addition, E6 variant NIKS expressing R10G/L83V and Q14H/H78Y/L83V were more prone to undergo cell-detachment-induced apoptosis (anoikis) than NIKS expressing E6 prototype. 2009 Virology Abstract HPV R10G;L83V;Q14H;H78Y;L83V 40;45;54;59;64 44;49;58;63;68 E6;E6 13;161 15;163 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. L83V-related variants of human papillomavirus (HPV) 16 E6, exemplified by the Asian-American variant Q14H/H78Y/L83V, were shown to be more prevalent than E6 prototype in progressing lesions and cervical cancer. 2009 Virology Abstract HPV L83V;Q14H;H78Y;L83V 0;101;106;111 4;105;110;115 E6;E6 55;154 57;156 Cervical carcinoma 194 209 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. The combined differentiation and apoptosis pattern of high-risk E6 variants, especially of Q14H/H78Y/L83V, may reflect a phenotype beneficial to carcinogenesis and viral life cycle. 2009 Virology Abstract HPV Q14H;H78Y;L83V 91;96;101 95;100;105 E6 64 66 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. We evaluated functions relevant to carcinogenesis for the E6 variants L83V, R10/L83V and Q14H/H78Y/L83V as well as the prototype in a model of human normal immortalized keratinocytes (NIKS). 2009 Virology Abstract HPV L83V;Q14H;H78Y;L83V;L83V 70;89;94;99;80 74;93;98;103;84 E6 58 60 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. F47R-senescent HeLa cells exhibit a sustained expression of p53, hMDM2 and p21(CIP) proteins and a reduced expression of endogenous HPV18 E6 protein. 2009 Oncogene Abstract HPV F47R 0 4 E6 138 140 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. Finally, small interfering RNAs directed against p53 counteract the effect of E6 F47R expression, indicating that E6 F47R-induced cellular senescence is strongly dependent on p53 signaling pathway. 2009 Oncogene Abstract HPV F47R;F47R 81;117 85;121 E6;E6 78;114 80;116 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. Here, we show that a single-point mutation, F47R, is sufficient to convert the HPV16 E6 oncoprotein into a suppressor of HPV-positive HeLa cervical cancer cells proliferation. 2009 Oncogene Abstract HPV F47R 44 48 E6 85 87 Cervical carcinoma 139 154 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. Moreover, the prolonged expression of E6 F47R leads to suppression of HeLa cells proliferation through the induction of premature senescence. 2009 Oncogene Abstract HPV F47R 41 45 E6 38 40 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. The E6 F47R mutant is defective for polyubiquitination and subsequent degradation of p53. 2009 Oncogene Abstract HPV F47R 7 11 E6 4 6 19015633 A single-codon mutation converts HPV16 E6 oncoprotein into a potential tumor suppressor, which induces p53-dependent senescence of HPV-positive HeLa cervical cancer cells. When expressed in HPV-positive cervical cancer cells, E6 F47R acts as a dominant negative mutant by counteracting the p53 degradation activity of endogenous E6 and restoring high p53 protein levels. 2009 Oncogene Abstract HPV F47R 57 61 E6;E6 54;157 56;159 Cervical carcinoma 31 46 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. CONCLUSION: We conclude that in the women included in this study the HPV16 E subtype is 19 times more frequent than the AA subtype; that the circulating E variants are E-P (71.1%) > E-T350G (18.4%) > E-C188G (5.3%); that 71.0% of the E-P sequences carry the A334G single nucleotide change and appear to correspond to a HPV16 variant characteristic of San Luis Potosi City more oncogenic than the E-P Ref prototype. 2009 Infectious agents and cancer Abstract HPV T350G;C188G;A334G 184;202;258 189;207;263 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. E-P A334G sequences were the most prevalent (22 cases, 57.9%), followed by the E-P Ref prototype (8 cases, 21.1%) and E-P A404T (1 case, 2.6%) sequences. 2009 Infectious agents and cancer Abstract HPV A334G;A404T 4;122 9;127 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. E-P variant sequences contained 23 single nucleotide changes, two of which (A334G, A404T) had not been described before and allowed the phylogenetic separation from the other variants. 2009 Infectious agents and cancer Abstract HPV A334G;A404T 76;83 81;88 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. RESULTS: Three European (E) variants (E-P, n = 27; E-T350G, n = 7; E-C188G, n = 2) and one AA-a variant (n = 2) were identified among the 38 HPV16 sequences analyzed. 2009 Infectious agents and cancer Abstract HPV T350G;C188G 53;69 58;74 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The HSIL + ICC fraction was 0.21 for the E-P A334G variants and 0.00 for the E-P Ref variants. 2009 Infectious agents and cancer Abstract HPV A334G 45 50 Squamous intraepithelial lesions;Cervical carcinoma 4;11 8;14 19256739 Distribution of HPV-16 intratypic variants among women with cervical intraepithelial neoplasia and invasive cervical cancer in Mongolia. Among the remaining 31 variants, variants with the T350G nucleotide change were predominant (13/31, 42%), followed by variants containing G94A (11/31, 35%), G176A (4/31, 13%) and G274T (2/31, 7%). 2008 Asian Pacific journal of cancer prevention Abstract HPV T350G;G94A;G176A;G274T 51;138;157;179 56;142;162;184 19358280 Molecular variants of HPV-16 associated with cervical cancer in Indian population. Similar distribution of the variants was seen from the different centres/regions, with the European variant E350G being the most prevalent (58%), followed by American Asian variant (11.4%). 2009 International journal of cancer Abstract HPV E350G 108 113 19358280 Molecular variants of HPV-16 associated with cervical cancer in Indian population. The most frequent being 448insS (100%), and 465delD (100%), H228D (94%), T292A (85%). 2009 International journal of cancer Abstract HPV 448insS;465delD;H228D;T292A 24;44;60;73 31;51;65;78 19358280 Molecular variants of HPV-16 associated with cervical cancer in Indian population. The most frequent being F57V (9%). 2009 International journal of cancer Abstract HPV F57V 24 28 19358280 Molecular variants of HPV-16 associated with cervical cancer in Indian population. The most frequent being L83V (72.3%), Q14H (13.1%) and H78Y (12.1%). 2009 International journal of cancer Abstract HPV L83V;Q14H;H78Y 24;38;55 28;42;59 19508521 Extensive anal condylomatosis: prognosis in relation to viral and host factors. Viral variant L83V was present in 3/4 HPV 16 positive recurrent cases. 2010 Colorectal disease Abstract HPV L83V 14 18 19626616 Genetic diversity of human papillomavirus type 16 E6, E7, and L1 genes in Italian women with different grades of cervical lesions. Among these, the R364C and N367D are located at the base of the HI-loop of the L1 protein, considered to be the immunodominant epitope of HPV 16. 2009 Journal of medical virology Abstract HPV R364C;N367D 17;27 22;32 L1 79 81 19626616 Genetic diversity of human papillomavirus type 16 E6, E7, and L1 genes in Italian women with different grades of cervical lesions. In the E7 gene, four nucleotide variations were identified with two leading to the amino acid substitutions L15V and S31R. 2009 Journal of medical virology Abstract HPV L15V;S31R 108;117 112;121 E7 7 9 19626616 Genetic diversity of human papillomavirus type 16 E6, E7, and L1 genes in Italian women with different grades of cervical lesions. Of these, the G134D and C136R fall within the CXXC zinger finger domain important for p53 binding. 2009 Journal of medical virology Abstract HPV G134D;C136R 14;24 19;29 19699050 Human papillomavirus type 16 E6 gene variations in Chinese population. CONCLUSION: The D25 E variant is the most prevalent E6 genomic variant in Hubei, China. 2010 European journal of surgical oncology Abstract HPV D25E 16 21 E6 52 54 19699050 Human papillomavirus type 16 E6 gene variations in Chinese population. The rank orders of incidence of HPV 16 prototype and E6 variants were as follows: D25E (62%), the prototype (17%), E113D (9%), L83V (6%) in case subjects; the prototype (71%), D25E (23%), L83V/E113D (7%) in control subjects. 2010 European journal of surgical oncology Abstract HPV E113D;L83V;D25E;D25E;E113D;L83V;L83D 115;127;82;176;193;188;193 120;131;86;180;198;192;198 E6 53 55 19860897 Role of L2 cysteines in papillomavirus infection and neutralization. Despite their lack of infectivity, HPV16 pseudovirions containing C22S or C28S mutant L2 bind to cell surfaces, are taken up, and expose the 17-36 region on the virion surface as for wild type HPV16 pseudovirions suggesting normal furin cleavage of L2. 2009 Virology journal Abstract HPV C22S;C28S 66;74 70;78 L2;L2 86;249 88;251 19860897 Role of L2 cysteines in papillomavirus infection and neutralization. HPV16 L2 mutations K20A, C22A, C22S, C28A, C28S, or P29A prevented RG-1 binding, whereas Y19A, K23A or Q24A had no impact. 2009 Virology journal Abstract HPV C22A;C22S;C28A;K20A;C28S;P29A;Y19A;K23A;Q24A 25;31;37;19;43;52;89;95;103 29;35;41;23;47;56;93;99;107 L2 6 8 19860897 Role of L2 cysteines in papillomavirus infection and neutralization. Mutation of the second cysteine residue in Bovine papillomavirus type 1 (BPV1) L2 to serine (C25S) dramatically reduced the infectivity of BPV1 pseudovirions. 2009 Virology journal Abstract HPV C25S 93 97 L2 79 81 19860897 Role of L2 cysteines in papillomavirus infection and neutralization. Surprisingly, in contrast to the double mutation in HPV16 L2, the BPV1 L2 C19S, C25S double mutation reduced BPV1 pseudovirion infectivity of 293TT cells by only half. 2009 Virology journal Abstract HPV C25S;C19S 80;74 84;78 L2;L2 58;71 60;73 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. An in vivo analysis using multiple catalytic site mutant dominant negative E2 enzymes show that the C92A E2-25K most effectively blocks E7-induced Rb proteolysis. 2010 Virology Abstract HPV C92A 100 104 E2;E2;E7 75;105;136 77;107;138 20104743 [Gene characterization of E6 and E7 gene of human papillomavirus of 15 cervical cancer in Beijing]. There were one nucleotide mutation at E6 position 335 (C-->T, H78Y) in 1 of 4 Europe prototype like virus. 2009 Zhonghua shi yan he lin chuang bing du xue za zhi Abstract HPV H78Y;C335T 62;50 66;61 E6 38 40 20104743 [Gene characterization of E6 and E7 gene of human papillomavirus of 15 cervical cancer in Beijing]. There were two nucleotide mutation at E6 position 178 (T-->G,D25E) and at E7 position 647 (A-->G, N29S) in 4 Asian type like viruses. 2009 Zhonghua shi yan he lin chuang bing du xue za zhi Abstract HPV T178G;A647G;N29S;D25E 50;86;98;61 61;97;102;65 E6;E7 38;74 40;76 20383192 The immortalizing and transforming ability of two common human papillomavirus 16 E6 variants with different prevalences in cervical cancer. The different prevalence is based on three amino acid changes within the E6 protein denoted Q14H/H78Y/L83V. 2010 Oncogene Abstract HPV Q14H;H78Y;L83V 92;97;102 96;101;106 E6 73 75 20402411 Genetic variability in E6, E7 and L1 protein of HPV81 from HIV-1 positive women in Italy. Among L1 immune-related regions, BC loop presented T56N in 1/5, while FGb loop presented T287N in 4/5 patients. 2010 The new microbiologica Abstract HPV T56N;T287N 51;89 55;94 L1 6 8 Breast neoplasms 33 35 20402411 Genetic variability in E6, E7 and L1 protein of HPV81 from HIV-1 positive women in Italy. Two substitutions (R492K and T493S) were observed in 5/5, one (T287N) in 4/5 patients. 2010 The new microbiologica Abstract HPV R492K;T493S;T287N 19;29;63 24;34;68 20423887 [Human papillomavirus type 16 variant analysis of upstream regulatory region and E6, E7 oncogene from cervical cancer patients in Beijing]. A total of 8 hot mutation spot was identi-fied, which were URR G7521A (100%), C7435G (96.77%), C24T (45.16%), A7729C (45.16%), G7839A (45.16%), E6 T178G (41.94%), E7 A647G (45.16%), and T846C (45.16%). 2010 Yi chuan Abstract HPV G7521A;C7435G;C24T;A7729C;G7839A;T178G;A647G;T846C 63;78;95;110;127;147;166;186 69;84;99;116;133;152;171;191 E6;E7;URR 144;163;59 146;165;62 20423887 [Human papillomavirus type 16 variant analysis of upstream regulatory region and E6, E7 oncogene from cervical cancer patients in Beijing]. Our results suggested that the mutations of G7521A, A7729C, G7839A, T178G, T350G, A647G, and G658A were likely to be associated with the enhanced oncogenic potential of HPV16 and oncogenesis of cer-vical cancer. 2010 Yi chuan Abstract HPV G7521A;A7729C;G7839A;T178G;T350G;A647G;G658A 44;52;60;68;75;82;93 50;58;66;73;80;87;98 Cervical carcinoma 194 210 20572344 [The enhancement of DNA binding ability of a mutated E2 (A338V) protein of HPV-2]. Previously we reported that the repression of a mutated E2 protein of HPV-2 isolated from a patient with huge common wart on the viral early promoter was obviously decreased, and A338V mutation located at the C terminal DNA binding region of E2 protein. 2010 Bing du xue bao Abstract HPV A338V 179 184 E2;E2 56;242 58;244 20870281 Distribution of human papillomavirus 58 and 52 E6/E7 variants in cervical neoplasia in Chinese women. CONCLUSIONS: These findings suggest that C632T (T20I) and G760A (G63S) variants in HPV58 E7 are probably risk factors associated with the development of cervical cancer in Chinese women. 2010 Gynecologic oncology Abstract HPV C632T;T20I;G760A;G63S 41;48;58;65 46;52;63;69 E7 89 91 Cervical carcinoma 153 168 20870281 Distribution of human papillomavirus 58 and 52 E6/E7 variants in cervical neoplasia in Chinese women. For HPV58, the presence of C632T (T20I) and G760A (G63S) variants in E7 showed a positive trend of the association with the severity of neoplasia (P(trend)<0.05, chi2 test for trend). 2010 Gynecologic oncology Abstract HPV C632T;T20I;G760A;G63S 27;34;44;51 32;38;49;55 E7 69 71 21051983 Distribution of human papillomavirus 16 E6/E7 variants in cervical cancer and intraepithelial neoplasia in Chinese women. In addition, 3 novel variants at E6 (Q20P, H118Q, and Q123K) and 2 at E7 (D75N and T86P) were found. 2010 International journal of gynecological cancer Abstract HPV Q20P;H118Q;Q123K;D75N;T86P 37;43;54;74;83 41;48;59;78;87 E6;E7 33;70 35;72 21051983 Distribution of human papillomavirus 16 E6/E7 variants in cervical cancer and intraepithelial neoplasia in Chinese women. The substitution G368T at E6 leading to a premature stop codon occurred in an isolate of normal control sample. 2010 International journal of gynecological cancer Abstract HPV G368T 17 22 E6 26 28 21159359 Expression of human papillomavirus type 16 E7 is sufficient to significantly increase expression of angiogenic factors but is not sufficient to induce endothelial cell migration. Conditioned media from HFKs expressing the HPV 16 E6 and the E7 mutant E7C24G, which can target p107 and p130 but not pRb for degradation, contained increased levels of VEGF and IL-8. 2011 Virology Abstract HPV C24G 73 77 E6;E7;E7 50;61;71 52;63;73 21274725 The E2 protein of human papillomavirus type 8 increases the expression of matrix metalloproteinase-9 in human keratinocytes and organotypic skin cultures. An E2 transactivation-defective mutant (I73L) as well as a DNA-binding deficient mutant (R433K) demonstrated no activation of the MMP9 promoter, suggesting that both an intact transactivation and DNA-binding domain are required for E2 activation of the MMP9-promoter. 2011 Medical microbiology and immunology Abstract HPV I73L;R433K 40;89 44;94 E2;E2 3;232 5;234 21436703 Genetic diversity of HPV-16 E6, E7, and L1 genes in women with cervical lesions in Liaoning Province, China. Sequences of the E6 gene revealed 4 amino acid changes of variants D25E and L83V, with 48.3% (69/143) and 11.2% (16/143), respectively, and variants H78Y and E113D in this study. 2011 International journal of gynecological cancer Abstract HPV D25E;L83V;H78Y;E113D 67;76;149;158 71;80;153;163 E6 17 19 21436703 Genetic diversity of HPV-16 E6, E7, and L1 genes in women with cervical lesions in Liaoning Province, China. The following L1 variations were found in this study: L103F, P104K, P104Y, P104S, D105G, P106S, N108P, F109V, C172S, H228D, and T292A. 2011 International journal of gynecological cancer Abstract HPV L103F;P104K;P104S;D105G;P106S;N108P;F109V;C172S;H228D;T292A;P104Y 54;61;75;82;89;96;103;110;117;128;68 59;66;80;87;94;101;108;115;122;133;73 L1 14 16 21436703 Genetic diversity of HPV-16 E6, E7, and L1 genes in women with cervical lesions in Liaoning Province, China. The results also showed the prevalence of 4 hot spots of E7 nucleotide variations leading to N29H, N29S, and 2 silent variations, nucleotide G666A and nucleotide T846C, with 4.2% (6/142), 43% (61/142), 32.4% (46/142), and 43% (61/142), respectively. 2011 International journal of gynecological cancer Abstract HPV N29H;N29S;G666A;T846C 93;99;141;162 97;103;146;167 E7 57 59 2152813 Mutational analysis of human papillomavirus type 16 E7 functions. It was abolished by changing Cys-24 to Gly and markedly decreased by a mutation at His-2 or at the metal-binding motifs in region 3. 1990 Journal of virology Abstract HPV C24G 29 42 21552834 Polymorphism of the hpv-16 e6 gene of cervical-carcinoma. Nine DNA samples had heterozygous mutations within the same region of the E6 gene 3' terminus; T to C transitions at HPV-16 position 511 (silent) and one of the nine also had a 513 mutation (Met to Thr). 1995 International journal of oncology Abstract HPV T511C 95 136 E6 74 76 21556519 In-vivo analysis of hpv e7 protein association with prb, p107 and p130. However, association with p107 and p130 by the HPV 6 E7 protein was also increased by mutation of the arginine at position 4 with an aspartate. 1995 International journal of oncology Abstract HPV R4D 102 142 E7 53 55 21556519 In-vivo analysis of hpv e7 protein association with prb, p107 and p130. Substitution of the glycine at position 22 with an aspartate was the only mutation capable of increasing the ability of HPV 6 E7 protein to bind pRb. 1995 International journal of oncology Abstract HPV G22D 20 60 E7 126 128 21593270 Human papillomavirus type 16 variant analysis of E6, E7, and L1 [corrected] genes and long control region in [corrected] cervical carcinomas in patients in northeast China. The most frequently observed variation sites were T178G (32.69%) in E6; A647G (34.62%), G666A (38.46%), and T846C (32.69%) in E7; C6826T (36.17%) and G7060A (61.70%) in L1; and G7521A (98.08%) in the LCR. 2011 Journal of clinical microbiology Abstract HPV T178G;A647G;G666A;T846C;C6826T;G7060A;G7521A 50;72;88;108;130;150;177 55;77;93;113;136;156;183 E6;E7;L1;LCR 68;126;169;200 70;128;171;203 21593270 Human papillomavirus type 16 variant analysis of E6, E7, and L1 [corrected] genes and long control region in [corrected] cervical carcinomas in patients in northeast China. The most prevalent amino acid variations were D25E in E6 and N29S in E7. 2011 Journal of clinical microbiology Abstract HPV D25E;N29S 46;61 50;65 E6;E7 54;69 56;71 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Interestingly, in a reporter based assay R8Q exhibited a higher ability to augment TCF/beta-catenin transcription. 2011 Molecular cancer Abstract HPV R8Q 41 44 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Like L83V, raft cultures derived from variants R10G and R48W similarly induced hyperplasia and aberrantly expressed keratin 5 in the suprabasal compartment with significantly lower expression of keratin 10. 2011 Molecular cancer Abstract HPV R10G;L83V;R48W 47;5;56 51;9;60 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. R8Q induced a unique phenotype characterized by thin organotypic raft cultures, low expression of keratin 10, and high expression of keratins 5 and 14 throughout all raft layers. 2011 Molecular cancer Abstract HPV R8Q 0 3 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Unlike L83V, both variants, and particularly R48W, induced increased levels of anoikis upon suspension in semisolid medium. 2011 Molecular cancer Abstract HPV L83V;R48W 7;45 11;49 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. We evaluated functions relevant to carcinogenesis for the rarely-detected European variants R8Q, R10G and R48W as compared to the commonly detected L83V. 2011 Molecular cancer Abstract HPV R8Q;R10G;R48W;L83V 92;97;106;148 95;101;110;152 21791360 Human papillomavirus type 16 E6 inhibits p21(WAF1) transcription independently of p53 by inactivating p150(Sal2). A HPV16 E6 mutant, L110Q, which was unable to bind p150(Sal2), did not affect the ability of the cellular protein to bind p21(WAF1) promoter, underlining the linkage between these events. 2011 Virology Abstract HPV L110Q 19 24 E6 8 10 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Previously, we have reported that the human papillomavirus (HPV) type 16 E6 D25E is the most prevalent variant in Korean women at high risk for cervical cancers. 2011 Virology journal Abstract HPV D25E 76 80 E6 73 75 Cervical carcinoma 144 160 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. These results further emphasize the unique biological activity of the HPV-16 E6 D25E variant. 2011 Virology journal Abstract HPV D25E 80 84 E6 77 79 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. To investigate whether the HPV-16 E6 D25E variant might influence cervical cancer progression, we used an oligonucleotide microarray approach to identify transcriptionally altered gene expression patterns in recombinant wild-type E6 or E6 D25E variant-expressing HPV-negative cancer cells. 2011 Virology journal Abstract HPV D25E;D25E 37;239 41;243 E6;E6;E6 34;230;236 36;232;238 Cervical carcinoma 66 81 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. We identified 14 genes, nine down-regulated and five up-regulated upon E6 D25E expression, compared with wild-type E6 expression. 2011 Virology journal Abstract HPV D25E 74 78 E6;E6 71;115 73;117 22001139 Human papillomaviruses 53 and 66: clinical aspects and genetic analysis. The L1 protein mutations S405P and D458N were exclusively found in patients with L-SILs. 2012 Virus research Abstract HPV S405P;D458N 25;35 30;40 L1 4 6 Squamous intraepithelial lesions 81 87 22001139 Human papillomaviruses 53 and 66: clinical aspects and genetic analysis. The novel L1 mutation P432L was statistically associated with L-SIL lesions (P=0.04) and its development reduced the L1 predicted antigenicity (up to -2.3 for Glu433). 2012 Virus research Abstract HPV P432L 22 27 L1;L1 10;117 12;119 Squamous intraepithelial lesions 62 75 22016834 An in vitro multistep carcinogenesis model for both HPV-positive and -negative human oral squamous cell carcinomas. To elucidate underlying processes, we transduced either HPV16 E6/E7 or mutant CDK4 (CDK4(R24C)), cyclin D1 and human telomerase reverse transcriptase (TERT) into primary human tongue keratinocytes (HTK), and obtained immortal cell populations, HTK-16E6E7 and HTK-K4DT. 2011 American journal of cancer research Abstract HPV R24C 89 93 E6;E7 62;65 64;67 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. E7C24G retained E7-wild-type capability to inhibit Miz-1-dependent transactivation. 2012 Virology Abstract HPV C24G 2 6 E7;E7 0;16 2;18 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. The C-terminal E7Delta79LEDLL83-mutant with reduced Miz-1-binding capacity was impaired in its capability to repress p21(Cip1) expression; whereas the pRB-binding-deficient E7C24G-mutant inhibited p21(Cip1) expression similar to wild-type E7. 2012 Virology Abstract HPV C24G 175 179 E7;E7 173;239 175;241 22131113 Prevalence of HPV 16 genomic variant carrying a 63 bp duplicated sequence within the E1 gene in Slovenian women. Recently, a novel, presumably less pathogenic, HPV-16 E6-T350G genomic variant has been identified, carrying a 63-bp in-frame insertion in the E1 gene. 2011 Acta dermatovenerologica Alpina, Pannonica, et Adriatica Abstract HPV T350G 57 62 E1;E6 143;54 145;56 22278827 Transactivation activity of human papillomavirus type 16 E6*I on aldo-keto reductase genes enhances chemoresistance in cervical cancer cells. Site-directed mutagenesis of 16E6*I revealed that transactivation activity was abolished in R8A, R10A and T17A 16E6*I mutants without altering their intracellular localization patterns. 2012 The Journal of general virology Abstract HPV R8A;R10A;T17A 92;97;106 95;101;110 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. CONCLUSIONS: These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation. 2012 BMC molecular biology Abstract HPV A338V 58 78 E2 95 97 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. Electrophoresis mobility shift assays (EMSA) showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. 2012 BMC molecular biology Abstract HPV A338V 97 102 LCR;E2;E2;E2 204;81;149;279 207;83;151;281 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. 2012 BMC molecular biology Abstract HPV A338V 55 60 E2 164 166 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. 2012 BMC molecular biology Abstract HPV L118S;S235P;Y287H;S293R;A338V 160;167;174;181;191 165;172;179;186;196 E2 152 154 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. RESULTS: CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. 2012 BMC molecular biology Abstract HPV A338V 139 144 E2 114 116 22333459 A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. 2012 BMC molecular biology Abstract HPV A338V 124 129 E2 69 71 22524831 Whole genome analysis of human papillomavirus type 16 multiple infection in cervical cancer patients. An amino acid variation N29S within the E7 oncoprotein significantly associated with severity of lesion was also discovered. 2012 Asian Pacific journal of cancer prevention Abstract HPV N29S 24 28 E7 40 42 22524831 Whole genome analysis of human papillomavirus type 16 multiple infection in cervical cancer patients. HPV16 European variant prone to single infection may harbor a major variation at L83V which significantly increases the risk for developing cervical carcinoma. 2012 Asian Pacific journal of cancer prevention Abstract HPV L83V 81 85 Cervical carcinoma 140 158 22524831 Whole genome analysis of human papillomavirus type 16 multiple infection in cervical cancer patients. In the E6 region, amino acid changes at L83V were related to increased cancer progression. 2012 Asian Pacific journal of cancer prevention Abstract HPV L83V 40 44 E6 7 9 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. CONCLUSION: The relatively high frequency of the R10G variant in TSCC, as compared to what has been found in CC both in the present study as well as in several other studies in different countries, may indicate a difference between TSCC and CC with regard to tumor induction and development. 2012 PloS one Abstract HPV R10G 49 53 Cervical carcinoma;Cervical carcinoma;Tonsillar squamous cell carcinoma;Tonsillar squamous cell carcinoma 109;241;65;232 111;243;69;236 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. RESULTS: The rare E6 variant R10G was relatively frequent (19%) in TSCC, absent in CC and infrequent (4%) in CS, while the well-known L83V variant was common in TSCC (40%), CC (31%), and CS (29%). 2012 PloS one Abstract HPV R10G;L83V 29;134 33;138 E6 18 20 Cervical carcinoma;Tonsillar squamous cell carcinoma;Tonsillar squamous cell carcinoma;Cervical carcinoma 83;67;161;173 85;71;165;175 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The difference for R10G was significant between TSCC and CC (p = 0.0003), as well as between TSCC and CS (p = 0.009). 2012 PloS one Abstract HPV R10G 19 23 Tonsillar squamous cell carcinoma;Tonsillar squamous cell carcinoma;Cervical carcinoma 48;93;57 52;97;59 22571619 Human papillomavirus type 58: the unique role in cervical cancers in East Asia. An HPV58 variant (E7 T20I, G63S) commonly detected in Hong Kong was found to confer a 6.9-fold higher risk of developing cervical cancer compared to other variants. 2012 Cell & bioscience Abstract HPV T20I;G63S 21;27 25;31 E7 18 20 Cervical carcinoma 121 136 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. Bayesian analysis identified several important amino acid positions that may be driving adaptive selection in the HPV 16 population, including R10G, D25E, L83V, and E113D in the E6 gene. 2012 PloS one Abstract HPV R10G;E113D;D25E;L83V 143;165;149;155 147;170;153;159 E6 178 180 22622951 Variant lineages of human papillomavirus type 18 in Northeast China populations characterized by sequence analysis of E6, E7, and L1 regions. All the L1 genes of the analyzed HPV 18 strains had 4 C-G transversions at nucleotide positions of 5701, 6460, 6625, and 6842 and one G-A transition at position 5503. 2012 International journal of gynecological cancer Abstract HPV G5503A 134 165 L1 8 10 22622951 Variant lineages of human papillomavirus type 18 in Northeast China populations characterized by sequence analysis of E6, E7, and L1 regions. Moreover, strains with L1 nucleotide variations of A5920T, A6431T, and G6987A leading to amino acid substitutions of A164V, Q334P/H, and D520N are novel variants. 2012 International journal of gynecological cancer Abstract HPV A5920T;A6431T;G6987A;A164V;Q334P;Q334H;D520N 51;59;71;117;124;124;137 57;65;77;122;131;131;142 L1 23 25 22622951 Variant lineages of human papillomavirus type 18 in Northeast China populations characterized by sequence analysis of E6, E7, and L1 regions. Strains with variations of C287G, T482C, and C519A in E6 and C751T in E7 were novel variants. 2012 International journal of gynecological cancer Abstract HPV C287G;T482C;C519A;C751T 27;34;45;61 32;39;50;66 E6;E7 54;70 56;72 22659102 Variations of human papillomavirus type 58 E6, E7, L1 genes and long control region in strains from women with cervical lesions in Liaoning province, China. Among them, the A140G (T11A), A184C (E25D), G266C (V53L) and A313G were novel variations. 2012 Infection, genetics and evolution Abstract HPV A140G;T11A;A184C;G266C;V53L;A313G;E25D 16;23;30;44;51;61;37 21;27;35;49;55;66;41 22659102 Variations of human papillomavirus type 58 E6, E7, L1 genes and long control region in strains from women with cervical lesions in Liaoning province, China. Sequencing of the E7 gene revealed four typical nucleotide changes: G761A (G63D), G694A (G41R), T803C (V77A) and T744G. 2012 Infection, genetics and evolution Abstract HPV G761A;G63D;G694A;G41R;T803C;V77A;T744G 68;75;82;89;96;103;113 73;79;87;93;101;107;118 E7 18 20 22659102 Variations of human papillomavirus type 58 E6, E7, L1 genes and long control region in strains from women with cervical lesions in Liaoning province, China. The most frequently observed variations were C307T (52.4%) in E6, T744G (74.9%) in E7, A6014C (56.9%) in L1 genes and C7266T, A7714G (55.2%) in LCR. 2012 Infection, genetics and evolution Abstract HPV C307T;T744G;A6014C;C7266T;A7714G 45;66;87;118;126 50;71;93;124;132 E6;E7;L1;LCR 62;83;105;144 64;85;107;147 22684534 Molecular and phylogenetic analysis of the HPV 16 E4 gene in cervical lesions from women in Greece. In addition, nine amino acid mutations (A7V, A7P, L16I, D45E, L59I, L59T, Q66P, S72F, H75Q) were detected in the E1( )E4 protein, and these were associated with the severity of cervical malignancy. 2012 Archives of virology Abstract HPV A7V;A7P;L16I;D45E;L59I;L59T;Q66P;S72F;H75Q 40;45;50;56;62;68;74;80;86 43;48;54;60;66;72;78;84;90 E1^E4 113 121 Cervical carcinoma 177 196 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. Furthermore, it appears that the silent variation 109T>C of the E-C109/G350 variant might have a significant role in the viral life cycle and warrants further study. 2012 PloS one Abstract HPV T109C;E-C109;E-G350 50;50;71 56;56;75 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. However, this study shows that the variations within the E1 region could possibly affect cervical disease, since the E1-1374^63nt E-G350 variant is significantly associated with lower grade cervical lesions, in comparison to the A1 and A2 sub-lineage variants. 2012 PloS one Abstract HPV E-G350 130 136 E1;E1 57;117 59;119 Cervical diseases;Cervical lesions 89;190 105;206 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. In comparison to the referent HPV16, the E1-1374^63nt E-G350 variant was significantly associated with lower grade cervical lesions (p = 0.029), while the E1-1374^63nt E-C109/G350 variant was equally distributed between high and low grade lesions. 2012 PloS one Abstract HPV E-G350;E-C109;E-G350 54;168;175 60;174;179 E1;E1 41;155 43;157 Cervical lesions 115 131 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The E1-1374^63nt duplication was linked with the E-G350 and the E-C109/G350 variants. 2012 PloS one Abstract HPV E-G350;E-C109 49;64 56;70 E1 4 6 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The E1-1374^63nt variants were phylogenetically closest to E-G350 variant lineage (A2 sub-lineage based on full genome classification). 2012 PloS one Abstract HPV E-G350 59 65 E1 4 6 23015309 Human papillomavirus type 52 polymorphism and high-grade lesions of the uterine cervix. CIN2,3 risk was significantly associated with a deletion at nucleotide position 7695 in the LCR (OR 4.9, 95% CI 1.2-20.8), the T7744C variation in the LCR (OR 5.7, 95% CI 1.1-32.0), and the K93R variation in E6 (OR 6.9, 95% CI 1.3-36.8), after adjusting for age, detection of HPV16 or 18 and study site. 2013 International journal of cancer Abstract HPV T7744C;K93R 127;190 133;194 LCR;LCR;E6 92;151;208 95;154;210 Cervical intraepithelial neoplasia 0 4 23124863 Codon 72 polymorphism of p53 and HPV type 16 E6 variants as risk factors for patients with squamous epithelial lesion of the uterine cervix. In addition, T350G HPV 16 variant was over-represented in p53 Arg homozygous women with cervical lesions. 2013 Journal of medical virology Abstract HPV T350G 13 18 Cervical lesions 88 104 23124863 Codon 72 polymorphism of p53 and HPV type 16 E6 variants as risk factors for patients with squamous epithelial lesion of the uterine cervix. The T350G HPV 16 variant was the most frequent variant observed in the analyzed group of Italian women, showing a slight decreasing with the severity of the lesion. 2013 Journal of medical virology Abstract HPV T350G 4 9 23124863 Codon 72 polymorphism of p53 and HPV type 16 E6 variants as risk factors for patients with squamous epithelial lesion of the uterine cervix. When p53 genotype and HPV 16 variants are considered together, no difference emerges between cases and controls so is not possible to assess that the oncogenic effect of HPV 16 T350G variant may be influenced by the p53 genotype. 2013 Journal of medical virology Abstract HPV T350G 177 182 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Africa had significantly more isolates with E6-367A (D86E) but significantly less isolates with E6-203G, -245G, -367C (prototype-like) than other regions (p <= 0.003). 2013 International journal of cancer Abstract HPV D86E 53 57 E6;E6 44;96 46;98 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. E7-632T, -760A (T20I, G63S) was more frequently found in Asia, and E7-793G (T74A) was more frequent in Africa (p < 0.001). 2013 International journal of cancer Abstract HPV T20I;G63S;T74A 16;22;76 20;26;80 E7;E7 0;67 2;69 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. In conclusion, T20I and/or G63S substitution(s) at E7 of HPV58 is/are associated with a higher risk for cervical neoplasia. 2013 International journal of cancer Abstract HPV T20I;G63S 15;27 19;31 E7 51 53 Cervical carcinoma 104 122 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Variants with T20I and G63S substitutions at E7 conferred a significantly higher risk for cervical intraepithelial neoplasia grade III and invasive cervical cancer compared to other HPV58 variants (odds ratio = 4.44, p = 0.007). 2013 International journal of cancer Abstract HPV T20I;G63S 14;23 18;27 E7 45 47 Cervical intraepithelial neoplasia;Cervical carcinoma 90;139 134;163 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Of the mutations found in the L1 gene, three novel nonsynonymous mutations of C5640T, A5641T and G5642A were located within the region that encodes the binding domain of neutralizing antibodies against HPV 52. 2012 International journal of molecular sciences Abstract HPV C5640T;A5641T;G5642A 78;86;97 84;92;103 L1 30 32 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The genetic variations of HPV 52, including three novel nonsynonymous mutations of C5640T, A5641T and G5642A in the L1 gene and a novel CTT7681-7683 deletion in the LCR, were first documented in strains from women in Northeast China. 2012 International journal of molecular sciences Abstract HPV C5640T;A5641T;G5642A 83;91;102 89;97;108 L1;LCR 116;165 118;168 23404471 Degradation of p53 by natural variants of the E6 protein of human papillomavirus type 16. These results suggest that the natural variants, E6 D25E and L83V, similar to the prototype E6 protein, contribute to tumorigenesis by degrading p53. 2013 Oncology reports Abstract HPV D25E;L83V 52;61 56;65 E6;E6 49;92 51;94 23404471 Degradation of p53 by natural variants of the E6 protein of human papillomavirus type 16. Two variants of E6 proteins, D25E and L83V, are common in cervical carcinomas among Asian and European populations. 2013 Oncology reports Abstract HPV D25E;L83V 29;38 33;42 E6 16 18 Cervical carcinoma 58 77 23404471 Degradation of p53 by natural variants of the E6 protein of human papillomavirus type 16. Two variants of E6 proteins, D25E and L83V, are common in cervical carcinomas among Asian and European populations. 2013 Oncology reports Abstract HPV D25E;L83V 29;38 33;42 E6 16 18 Cervical carcinoma 58 77 23404471 Degradation of p53 by natural variants of the E6 protein of human papillomavirus type 16. We demonstrate that both the D25E and L83V variants downregulate p53 through a ubiquitin-proteasome pathway, and that the effect is very similar to that of the prototype E6 protein. 2013 Oncology reports Abstract HPV D25E;L83V 31;40 35;44 E6 173 175 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. In addition, we have identified several novel variations: A551C in E6, G6906A in L1, and C4915T and C5147A in L2. 2013 PloS one Abstract HPV A551C;G6906A;C4915T;C5147A 58;71;89;100 63;77;95;106 E6;L1;L2 67;81;110 69;83;112 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. The most frequently observed variation was a C to G transversion at nucleotide 287 of E6, which was found in 48.2% of samples. 2013 PloS one Abstract HPV C287G 45 82 E6 86 88 23588734 E6 and E7 variants of human papillomavirus-16 and -52 in Japan, the Philippines, and Vietnam. There was no significant relationship between abnormal cervical cytology and either HPV-16 E6/E7 lineages or specific amino acid mutations, such as E6 D25E, E6 L83V, and E7 N29S. 2013 Journal of medical virology Abstract HPV D25E;L83V;N29S 151;160;173 155;164;177 E6;E7;E6;E6;E7 91;94;148;157;170 93;96;150;159;172 23609590 Human papillomavirus prevalence in invasive anal cancers in the United States before vaccine introduction. Among HPV-16-positive cases, 37% were identified as prototype variant Ep, and 63% were nonprototypes: 33% Em, 12% E-G131G, 5% Af1, 4% AA/NA-1, 3% E-C109G, 3% E-G131T, 2% As, and 1% Af2. 2013 Journal of lower genital tract disease Abstract HPV G131G;C109G;G131T 116;148;160 121;153;165 23649705 Genomic differences in the background of different severity in juvenile-onset respiratory papillomatoses associated with human papillomavirus type 11. A72E in E1 and Q86K in E2 proteins were exclusively present in a moderately aggressive disease, L1 alterations A476V and S486F were unique to a severe papillomatosis. 2013 Medical microbiology and immunology Abstract HPV A72E;Q86K;A476V;S486F 0;15;111;121 4;19;116;126 E1;E2;L1 8;23;96 10;25;98 Aggressive disease;Papilloma 76;151 94;165 23649705 Genomic differences in the background of different severity in juvenile-onset respiratory papillomatoses associated with human papillomavirus type 11. HPV11s in both solitary papillomas had identical LCRs containing a T7546C polymorphism, which strongly attenuated LCR activity, as confirmed by site-directed mutagenesis. 2013 Medical microbiology and immunology Abstract HPV T7546C 67 73 LCR;LCR 49;114 53;117 Papilloma 15 34 23649705 Genomic differences in the background of different severity in juvenile-onset respiratory papillomatoses associated with human papillomavirus type 11. This strong attenuator polymorphism was also present in the other four genomes showing significantly higher activities, but in these other alterations with demonstrable but statistically not significant attenuating (A7413C, 7509 T deletion) or enhancing (C7479T, T7904A) effect on transactivating potential (as demonstrated by site-directed mutagenesis) were also detected. 2013 Medical microbiology and immunology Abstract HPV A7413C;C7479T;T7904A 216;255;263 222;261;269 23852681 Intratypic variants of human papillomavirus type 16 and risk of cervical neoplasia in Taiwan. Similar significant associations with cervical intraepithelial neoplasia grade 3 or worse were also observed for distinct nucleotide substitutions, including T178A/G, A647G, A7730C/G, T7781C, G7842A, and C24T/G. 2013 Journal of medical virology Abstract HPV T178A;T178G;A647G;A7730C;A7730G;T7781C;G7842A;C24T;C24G 158;158;167;174;174;184;192;204;204 165;165;172;182;182;190;198;210;210 Cervical intraepithelial neoplasia 38 80 23881083 Nucleotide polymorphisms of the human papillomavirus 16 E1 gene. Of these nucleotide variations, A1668G, G2073A, T2169C, T2189C, A2453T, C2454T, A2587T and G2650A were identified only in high-grade dysplasia cases. 2014 Archives of virology Abstract HPV A1668G;G2073A;T2169C;T2189C;A2453T;C2454T;A2587T;G2650A 32;40;48;56;64;72;80;91 38;46;54;62;70;78;86;97 High-grade dysplasia 122 142 23946477 Molecular and evolutionary analysis of HPV16 E6 and E7 genes in Greek women. Human papillomavirus type 16 (HPV16) non-European variants have been associated with persistent infection and cervical cancer development, while the L83V variant of the E6 gene has been correlated with the progression of cervical malignancy. 2013 Journal of medical microbiology Abstract HPV L83V 149 153 E6 169 171 Cervical carcinoma;Cervical carcinoma 110;221 125;240 23946477 Molecular and evolutionary analysis of HPV16 E6 and E7 genes in Greek women. Moreover, the prototype and E6 L83V variants were both prevalent in high- and low-grade malignancies in Greek women. 2013 Journal of medical microbiology Abstract HPV L83V 31 35 E6 28 30 High- and low-grade neoplasms 68 100 23946477 Molecular and evolutionary analysis of HPV16 E6 and E7 genes in Greek women. Novel sequence variations were recorded within the E6 and E7 genes in cervical samples, characterized as (T350G) European variants. 2013 Journal of medical microbiology Abstract HPV T350G 106 111 E6;E7 51;58 53;60 23946477 Molecular and evolutionary analysis of HPV16 E6 and E7 genes in Greek women. The E6 L83V variant was found in 78.2 % of high- and 64.28 % of low-grade specimens. 2013 Journal of medical microbiology Abstract HPV L83V 7 11 E6 4 6 23946477 Molecular and evolutionary analysis of HPV16 E6 and E7 genes in Greek women. The present study investigated the presence of the HPV16 L83V variant in Greek women. 2013 Journal of medical microbiology Abstract HPV L83V 57 61 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. At the amino acid level, the most prevalent non-synonymous variants were L83V (T350G), H78Y (C335T), E113D (A442C), Q14D (C143G/G145T) and R10I (G132T), and were observed respectively in 65%, 41.8%, 38.8%, 30.1% and 23.3% of total samples.Moreover, HPV16 European variants were mostly identified in younger women at early clinical diagnosis stages. 2013 BMC infectious diseases Abstract HPV L83V;T350G;H78Y;C335T;A442C;Q14D;C143G;G145T;R10I;G132T;E113D 73;79;87;93;108;116;122;128;139;145;101 77;84;91;98;113;120;127;133;143;150;106 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. The Af and NA1 variants were detected in 31.1% and 11.6% of the HPV16 positive specimens, respectively, whereas, only 3% of cases were prototype E350T. 2013 BMC infectious diseases Abstract HPV E350T 145 150 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. An association between a co-variation of R10G/L83V in E6 and C7294T in LCR and an increased risk for developing CIN-2,3 was found in a HPV16 infected population of Chinese women. 2013 BMC cancer Abstract HPV R10G;L83V;C7294T 41;46;61 45;50;67 E6;LCR 54;71 56;74 HPV infections;Cervical intraepithelial neoplasia 135;112 149;119 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Based on the HPV16 prototype, the most frequent variation in the E6 gene was T178A/G (48.7%), followed by mutations of G94A (12.2%) and T350G (9.9%). 2013 BMC cancer Abstract HPV T178A;T178G;G94A;T350G 77;77;119;136 84;84;123;141 E6 65 67 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Occurrence of >=CIN2,3 was significantly associated with the mutations of R10G/L83V in E6 and the C7294T co-variation in LCR, after adjusting for ages of infected patients. 2013 BMC cancer Abstract HPV R10G;L83V;C7294T 74;79;98 78;83;104 E6;LCR 87;121 89;124 Cervical intraepithelial neoplasia 16 20 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The most commonly observed LCR variations were the transition replacement G7193T, 7434CIns, G7521A and 7863ADel (100%). 2013 BMC cancer Abstract HPV G7193T;G7521A;7434CIns;7863ADel 74;92;82;103 80;98;90;111 LCR 27 30 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The rank orders of incidence of E6 variations in amino acid were as follows: D25E (46.3%), L83V (9.9%) and H78Y (4.3%). 2013 BMC cancer Abstract HPV D25E;L83V;H78Y 77;91;107 81;95;111 E6 32 34 24150786 Functional effects of sequence variations in the E6 and E2 genes of human papillomavirus 16 European and Asian variants. A rare variation, EUR E6-R10G, was found to shorten the half-life of p53 more efficiently than the other variations. 2014 Journal of medical virology Abstract HPV R10G 25 29 E6 22 24 24150786 Functional effects of sequence variations in the E6 and E2 genes of human papillomavirus 16 European and Asian variants. By Western blot analysis, a similar ability to degrade p53 was observed among EUR E6, As E6, EUR E6-L83V and As E6-E113D. 2014 Journal of medical virology Abstract HPV L83V;E113D 100;115 104;120 E6;E6;E6;E6 82;89;97;112 84;91;99;114 24150786 Functional effects of sequence variations in the E6 and E2 genes of human papillomavirus 16 European and Asian variants. Furthermore, the site-directed mutagenesis revealed that E232K, which is a linked variation in the hinge region of As E2, was responsible for its enhanced repression ability. 2014 Journal of medical virology Abstract HPV E232K 57 62 E2 118 120 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. In transient replication assays, a novel E1 mutant found in ICC, E1 Q381E, showed reduced ability to support HPV16 origin-dependent replication. 2013 PloS one Abstract HPV Q381E 68 73 E1;E1 41;65 43;67 Cervical carcinoma 60 63 24368255 Genetic variability of HPV-58 E6 and E7 genes in Southwest China. 4 single nucleotide changes were identified among the E6 sequences with 3/4 synonymous mutations (C187T, A260C, C307T) and 1/4 non-synonymous mutations (A388C, from Lys to Asn, in alpha helix). 2014 Infection, genetics and evolution Abstract HPV C187T;A260C;C307T;A388C 98;105;112;153 103;110;117;158 E6 54 56 24368255 Genetic variability of HPV-58 E6 and E7 genes in Southwest China. 8 single nucleotide changes were identified among the HPV-58 E7 sequences with 2/8 synonymous mutations (T726C, T744G) and 6/8 non-synonymous mutations (G599A, C632T, G694A, G760A, G761A, T803C). 2014 Infection, genetics and evolution Abstract HPV T726C;T744G;G599A;C632T;G694A;G760A;G761A;T803C 105;112;153;160;167;174;181;188 110;117;158;165;172;179;186;193 E7 61 63 24368255 Genetic variability of HPV-58 E6 and E7 genes in Southwest China. The most common mutations of E6 genes are the C307T and A388C. 2014 Infection, genetics and evolution Abstract HPV C307T;A388C 46;56 51;61 E6 29 31 24368255 Genetic variability of HPV-58 E6 and E7 genes in Southwest China. The most common mutations of E7 genes are C632T, G694A, T744G, G760A (from Gly to Ser, in turn), G761A and T803C. 2014 Infection, genetics and evolution Abstract HPV C632T;G694A;T744G;G760A;G761A;T803C 42;49;56;63;97;107 47;54;61;68;102;112 E7 29 31 24456830 Replication interference between human papillomavirus types 16 and 18 mediated by heterologous E1 helicases. HPV16 E1 co-precipitated with HPV18 E1 in the cell lysates, and an HPV16 E1 mutant Y379A, which bound to HPV18 E1 less efficiently, failed to inhibit HPV18 replication. 2014 Virology journal Abstract HPV Y379A 83 88 E1;E1;E1;E1 6;36;73;111 8;38;75;113 24601042 Research on sequence variations analysis of HPV-16 type in Southwestern China. RESULTS: Compared with the European-Germanyl31 (EG131), 20 mutations were detected, of which eight mutations were detected from all the four biopsies: 131(G-A)(Gly-Arg), 178 (T-G)(Asp-Glu),350 (G-T)(Val-Leu), 647 (A-G)(Asn-Asp),846 (T-C) (synonymous mutation), L1 966th (C-T)(synonymous mutation),L1 1302 (C-T)(synonymous mutation) and L1 1434th (A-G) (synonymous mutation). 2013 European journal of gynaecological oncology Abstract HPV T178G;A647G;T846C;C1302T;G350T 170;209;228;300;189 179;218;237;310;198 L1;L1;L1 261;297;336 263;299;338 24610458 HPV16 E6 variants: frequency, association with HPV types and in silico analysis of the identified novel variants. Phylogenetic analysis revealed that the variant F69L + L83V is not related to any of these lineages, while the variant M137L + L83V is closely related to the North American variant. 2014 Journal of medical virology Abstract HPV F69L;L83V;M137L;L83V 48;55;119;127 52;59;124;131 24610458 HPV16 E6 variants: frequency, association with HPV types and in silico analysis of the identified novel variants. The results revealed that the European T350G was the most common variant (50%) followed by the European prototype (40.3%) and the North-American (N = 3; 4.8%). 2014 Journal of medical virology Abstract HPV T350G 39 44 24610458 HPV16 E6 variants: frequency, association with HPV types and in silico analysis of the identified novel variants. while the European T350G variants were seen in women with co-infections. 2014 Journal of medical virology Abstract HPV T350G 19 24 24696483 Restoration of MAGI-1 expression in human papillomavirus-positive tumor cells induces cell growth arrest and apoptosis. In this study, we describe the generation of a mutation, K499E, within the MAGI-1 PDZ1 domain, which is resistant to E6 targeting. 2014 Journal of virology Abstract HPV K499E 57 62 E6 117 119 24696483 Restoration of MAGI-1 expression in human papillomavirus-positive tumor cells induces cell growth arrest and apoptosis. While the K499E mutation does not significantly affect these intrinsic activities of MAGI-1 in HPV-negative cells, its resistance to E6 targeting in an HPV-positive setting results in more cells expressing the mutant MAGI-1 than the wild-type MAGI-1, with a corresponding increase in TJ assembly, induction of apoptosis, and reduction in cell proliferation. 2014 Journal of virology Abstract HPV K499E 10 15 E6 133 135 24798431 Human papillomavirus 16 oncoprotein E7 stimulates UBF1-mediated rDNA gene transcription, inhibiting a p53-independent activity of p14ARF. Co-expression of a pRb-binding-deficient mutant (E7C24G) and p14ARF resulted in EC24G nucleolar accumulation, but not in a significant higher activation of rDNA transcription, suggesting that the inactivation of pRb is involved in this phenomenon. 2014 PloS one Abstract HPV C24G 51 55 E7 49 51 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Monitoring intra-lineage, site-specific variants, such as T350G, is unlikely to be of diagnostic value. 2014 Infection, genetics and evolution Abstract HPV T350G 58 63 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. None of these sites, however, including the T350G non-synonymous (L83V) substitution in E6, alone or in combination, were found to be associated with cervical disease stage. 2014 Infection, genetics and evolution Abstract HPV T350G;L83V 44;66 49;70 E6 88 90 Cervical diseases 150 166 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C229S mutant virions form, but are non-infectious. 2014 PloS one Abstract HPV C229S 0 5 25096873 Maturation of the human papillomavirus 16 capsid. A C175S mutant that cannot achieve normal inter-L1 disulfide cross-links shows maturation-related shrinkage but does not achieve the fully condensed 60-nm form. 2014 mBio Abstract HPV C175S 2 7 L1 48 50 25111286 Prevalence of HPV and variation of HPV 16/HPV 18 E6/E7 genes in cervical cancer in women in South West China. HPV 16 E6-D25E, E7-N29S and E7-T846C (S95S) exhibited a prevalent linkage mutation. 2014 Journal of medical virology Abstract HPV D25E;N29S;T846C;S95S 10;19;31;38 14;23;36;42 E6;E7;E7 7;16;28 9;18;30 25143263 Molecular variants of human papilloma virus 16 E2, E4, E5, E6 and E7 genes associated with cervical neoplasia in Romanian patients. Two new missense mutations in the E6 gene (C279G and A305C) were found (together or alone, in association with other mutations) in 44 of 124 cases. 2014 Archives of virology Abstract HPV C279G;A305C 43;53 48;58 E6 34 36 25227848 A novel mutant of human papillomavirus type 18 E6E7 fusion gene and its transforming activity. At the same time, for safety future clinical application, a mutant of HPV18 ofE6E7 fusion gene was generated by site-directed mutagenesis at L52G for the E6 protein and C98G for the E7 protein. 2014 Asian Pacific journal of cancer prevention Abstract HPV L52G;C98G 141;169 145;173 E6;E7 154;182 156;184 25262469 HPV16 E6 and E6AP differentially cooperate to stimulate or augment Wnt signaling. Coexpression of wild-type or mutant E6AP (C820A) in Wnt-activated cells stabilized E6 and enhanced Wnt/beta-catenin/TCF transcription. 2014 Virology Abstract HPV C820A 42 47 E6 83 85 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. In addition, the S243A E2 protein has a shorter half-life than the wild type, indicating that phosphorylation of the HPV-16 E2 protein at serine 243 also increases its half-life. 2014 PloS one Abstract HPV S243A 17 22 E2;E2 23;124 25;126 25483514 Anti-tumor effects of genetic vaccines against HPV major oncogenes. These E7 and E6 vaccines were made with mutated oncogenes, the E7GGG mutant that does not bind pRb and the E6F47R mutant that is less effective in inhibiting p53, respectively. 2015 Human vaccines & immunotherapeutics Abstract HPV F47R 109 113 E6;E6;E7 13;107;6 15;109;8 25702585 High-sensitivity human papilloma virus genotyping reveals near universal positivity in anal squamous cell carcinoma: different implications for vaccine prevention and prognosis. HPV 16 accounted for 89%; of these, 64% harboured the T350G E6 variant. 2015 European journal of cancer (Oxford, England Abstract HPV T350G 54 59 E6 60 62 25735347 Mutation detection of E6 and LCR genes from HPV 16 associated with carcinogenesis. In the E6 sequences, the most common mutation was T350G (L83V), detected in 67% of the samples, associated with increased risk of persistent infection. 2015 Asian Pacific journal of cancer prevention Abstract HPV T350G;L83V 50;57 55;61 E6 7 9 25735347 Mutation detection of E6 and LCR genes from HPV 16 associated with carcinogenesis. The most frequent mutation in LCR sequences was G7521A, in 80% of the analyzed samples; it affects the binding site of a transcription factor that could contribute to carcinogenesis. 2015 Asian Pacific journal of cancer prevention Abstract HPV G7521A 48 54 LCR 30 33 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. METHODS: In this study, DNA and fowlpox virus recombinants expressing the E6F47R mutant of the HPV-16 E6 oncoprotein were generated, and their correct expression verified by RT-PCR, Western blotting and immunofluorescence. 2015 Journal of translational medicine Abstract HPV F47R 76 80 E6;E6 74;102 76;104 25800725 Identification of human papillomavirus-16 E6 variation in cervical cancer and their impact on T and B cell epitopes. Interestingly, the presence of variation H78Y and L83V result in creation of four new epitopes for the HLA-DQA1*0101/DQB1*0501. 2015 Journal of virological methods Abstract HPV H78Y;L83V 41;50 45;54 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Eight new E6 variants were found and 2 of them lead to amino acid change: E-C183/G350 (I27T) and E-C306/G350 (K68T). 2015 Virology journal Abstract HPV I27T;K68T 87;110 91;114 E6 10 12 25968097 Physical Status and Variant Analysis of Human Papillomavirus 16 in Women from Shanghai. Amino acid changes of D25E and N29S were the most common variations across the genome. 2016 Gynecologic and obstetric investigation Abstract HPV D25E;N29S 22;31 26;35 25968097 Physical Status and Variant Analysis of Human Papillomavirus 16 in Women from Shanghai. Furthermore, 10 novel variations were identified in this study, which led to the 3 amino acid changes of S23I in E2 and E244K and T269I in E2/E4. 2016 Gynecologic and obstetric investigation Abstract HPV S23I;T269I;E244K 105;130;120 109;135;125 E2;E2;E4 113;139;142 115;141;144 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. CONCLUSIONS: E6D25E of the HPV16As variant differed from the E6 prototype in its activities on epigenetic modulation and immune surveillance and this might be a key factor for the important role of this variant in cervical cancer progression. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E 15 19 E6;E6 13;61 15;63 Cervical carcinoma 214 229 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. HCK1T cells expressing E6D25E or E6Pro were established by transducing retrovirus-containing E6D25E or 16E6Pro. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E;D25E 25;95 29;99 E6;E6 23;93 25;95 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. Interestingly, E6D25E showed a higher activity of miR-21 induction than did E6Pro in C33A cells expressing E6 protein. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E 17 21 E6;E6 15;107 17;109 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. Interestingly, when treated with HeLa-CM, IRFs 1, 3 and 7 as well as c-fos were significantly suppressed in the HCK1T cells expressing E6D25E, whereas those in the HCK1T cells expressing E6Pro were induced. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E 137 141 E6 135 137 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. MATERIALS AND METHODS: Vectors expressing E6 protein of HPV16As (E6D25E) or HPV16 prototype (E6Pro) were constructed and transfected into C33A cells. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E 67 71 E6;E6 42;65 44;67 25987069 Activities of E6 Protein of Human Papillomavirus 16 Asian Variant on miR-21 Up-regulation and Expression of Human Immune Response Genes. RESULTS: E6D25E showed binding activity with E6AP similar to that of E6Pro. 2015 Asian Pacific journal of cancer prevention Abstract HPV D25E 11 15 E6 9 11 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. E7 genomic region was found to be highly conserved with two most common T789C and T795G (100%) silent variations. 2015 Infectious agents and cancer Abstract HPV T789C;T795G 72;82 77;87 E7 0 2 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The missense mutation G622A (D21N) in the E7 region seems to be described for the first time in this study. 2015 Infectious agents and cancer Abstract HPV G622A;D21N 22;29 27;33 E7 42 44 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The most frequently observed nucleotide variations were the missense C143G, G145T and C335T in E6 (100%), leading to the non-synonymous amino acid variation Q14D and H78Y. 2015 Infectious agents and cancer Abstract HPV C143G;G145T;C335T;Q14D;H78Y 69;76;86;157;166 74;81;91;161;170 E6 95 97 26192265 Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China. D32E/M28V/L94P mutation was higher in the cervical cancer and precancer compared with the prototype. 2016 Journal of medical virology Abstract HPV D32E;M28V;L94P 0;5;10 4;9;14 Cervical carcinoma 42 57 26192265 Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China. HPV-16 E6/E7 genetic variations, such as D32E/M28V/L94P, are more prevalent in cervical cancer or precancer than those in the controls. 2016 Journal of medical virology Abstract HPV D32E;M28V;L94P 41;46;51 45;50;55 E6;E7 7;10 9;12 Cervical carcinoma 79 94 26192265 Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China. Mutations were simultaneously detected at the E6-D32E (T96A) and E7-M28V (A82G)/L94P (T281C) sites of the amino acid sequence. 2016 Journal of medical virology Abstract HPV T96A;A82G;L94P;T281C;D32E;M28V 55;74;80;86;49;68 59;78;84;91;53;72 E6;E7 46;65 48;67 26192265 Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China. The most common genetic variation was D32E/M28V/L94P, which accounted for 35.8% of the cases (29/81). 2016 Journal of medical virology Abstract HPV D32E;M28V;L94P 38;43;48 42;47;52 26318249 The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. Of focus in this study is the European-T350G variant, which is characterized by an L>V amino acid substitution at residue 83 of the prototype E6 protein. 2015 Virology Abstract HPV T350G 30 44 E6 142 144 26318249 The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. To elucidate the functional effects of this polymorphism, we followed keratinocytes transduced with E-T350G E6 for over 60 passages and compared them to keratinocytes transduced, in parallel, with prototype or Asian-American (Q14H/L83V/H78Y) E6. 2015 Virology Abstract HPV Q14H;L83V;T350G 226;231;100 230;235;107 E6;E6 108;242 110;244 26318249 The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. We also found that E-T350G down-regulated E-cadherin compared to the other variants, providing a possible link between its population-based oncogenicity and host genetic variations. 2015 Virology Abstract HPV T350G 19 26 26318249 The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. We found that although E-T350G E6 immortalized transduced keratinocytes in the absence of E7, these cells were not fully transformed. 2015 Virology Abstract HPV T350G 23 30 E6;E7 31;90 33;92 26339417 Variants of human papillomavirus type 16 predispose toward persistent infection. It was found that the variants T178G, T350G and A442C in the E6 gene, as well as C3158A and G3248A variants in the E2 gene were associated with persistent HPV16 infection. 2015 International journal of clinical and experimental pathology Abstract HPV T178G;T350G;A442C;C3158A;G3248A 31;38;48;81;92 36;43;53;87;98 E2;E6 115;61 117;63 HPV infections 155 170 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. In the present study, L500F (V16) variation showed a significant ~2.7 fold (p < 0.002) increase in antibody titer, whereas T379P (V8) showed ~0.4 fold (p < 0.328) decrease after final injection. 2015 Scientific reports Abstract HPV L500F;T379P 22;123 27;128 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. METHODS: We investigated the effects of UV induced DNA damage in murine models of beta-PV E6 oncoprotein driven skin tumorigenesis by crossing K14-HPV8-E6wt mice (developing skin tumors after UV treatment) with K14-CPD-photolyase animals and by generating the K14-HPV8-E6-K136N mutant mouse strain. 2015 Molecular cancer Abstract HPV K136N 272 277 E6;E6 90;269 92;271 Skin tumor 174 185 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Whereas all K14-HPV8-E6wt animals develop skin tumors after UV expression of the HPV8-E6-K136N mutant significantly blocked skin tumor development after UV treatment. 2015 Molecular cancer Abstract HPV K136N 89 94 E6 86 88 Skin tumor;Skin tumor 42;124 53;134 26732286 Enhanced expression of soluble human papillomavirus L1 through coexpression of molecular chaperonin in Escherichia coli. Coexpressing the mono-site mutant HPV16 L1 L469A with GroEL/ES increased L1-p yield by ~7 fold compared with strains expressing the wild-type L1 gene. 2016 Protein expression and purification Abstract HPV L469A 43 48 L1;L1;L1 40;73;142 42;75;144 26739674 Distribution of human papillomavirus type 16 variants in Lithuanian women with cervical cancer. CONCLUSIONS: The European HPV 16 L83V variant is usually associated with high risk of cervical cancer among women. 2015 Medicina (Kaunas, Lithuania) Abstract HPV L83V 33 37 Cervical carcinoma 86 101 26739674 Distribution of human papillomavirus type 16 variants in Lithuanian women with cervical cancer. However, statistically significant difference was not achieved when comparing difference of L83V variants between investigated groups and in HPV 16 L83V variant and prototype distribution in CIN3/Ca in situ and cancer. 2015 Medicina (Kaunas, Lithuania) Abstract HPV L83V;L83V 92;148 96;152 26739674 Distribution of human papillomavirus type 16 variants in Lithuanian women with cervical cancer. In 33 cases (34.4%) HPV 16 prototype was detected; in 50 cases (52.1%), L83V variant; and in remaining 13 cases (13.5%), multivariant of HPV 16. 2015 Medicina (Kaunas, Lithuania) Abstract HPV L83V 72 76 26739674 Distribution of human papillomavirus type 16 variants in Lithuanian women with cervical cancer. The frequency of L83V variant in invasive cancer and carcinoma in situ samples was the same (66.7% and 62.0%, respectively; P=0.696). 2015 Medicina (Kaunas, Lithuania) Abstract HPV L83V 17 21 27030265 The Human Papillomavirus 16 E7 Oncoprotein Attenuates AKT Signaling To Promote Internal Ribosome Entry Site-Dependent Translation and Expression of c-MYC. Attenuation of phosphorylated AKT (pAKT) by E7 was independent of the Rb degradation function of E7 but could be ablated by a missense mutation in the E7 carboxy terminus, H73E, thereby defining a novel structure-function phenotype for E7. 2016 Journal of virology Abstract HPV H73E 172 176 E7;E7;E7;E7 44;97;151;236 46;99;153;238 27038009 Association between human papillomavirus type 16 E6 and E7 variants with subsequent persistent infection and recurrence of cervical high-grade squamous intraepithelial lesion after conization. (ii) The European variant E6 T350G/A442C may be associated with higher rates of recurring and persistent HPV16 infection after the LEEP. 2016 Journal of medical virology Abstract HPV T350G;A442C 29;35 34;40 E6 26 28 HPV infections 105 120 27038009 Association between human papillomavirus type 16 E6 and E7 variants with subsequent persistent infection and recurrence of cervical high-grade squamous intraepithelial lesion after conization. The patients with European variants T350G or A442C had a significantly higher incidence of persistent and recurring HPV16 infection. 2016 Journal of medical virology Abstract HPV T350G;A442C 36;45 41;50 HPV infections 116 131 27546189 Association of human papillomavirus type 16 and its genetic variants with cervical lesion in Korea. The most commonly observed LCR variations were 7521G>A (91.5%), 7730A>C (59.6%), and 7842G>A (59.6%). 2016 APMIS Abstract HPV G7521A;A7730C;G7842A 47;64;85 54;71;92 LCR 27 30 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. Frequencies for alleles in the HPV16 E6 T350G polymorphism were similar across anogenital cancers from the same geographical origin. 2016 Cancer medicine Abstract HPV T350G 40 45 E6 37 39 Anogenital cancers 79 97 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. We have assessed the contribution of geography and anatomy to the differential prevalence of HPV16 variants and to the nonsynonymous E6 T350G polymorphism. 2016 Cancer medicine Abstract HPV T350G 136 141 E6 133 135 27693214 Identification of the impact on T- and B- cell epitopes of human papillomavirus type-16 E6 and E7 variant in Southwest China. E6 72-83 for HLA-A*02:01 and E6 74-84 for HLA-B*15:02 maybe are the new direct for therapeutic vaccine aimed at L83V variants. 2017 Immunology letters Abstract HPV L83V 112 116 E6;E6 0;29 2;31 27693214 Identification of the impact on T- and B- cell epitopes of human papillomavirus type-16 E6 and E7 variant in Southwest China. For the B-cell epitopes, three most potent epitopes for E6 were listed, and N29S lead the growth of score from 0.81 to 0.83. 2017 Immunology letters Abstract HPV N29S 76 80 E6 56 58 27693214 Identification of the impact on T- and B- cell epitopes of human papillomavirus type-16 E6 and E7 variant in Southwest China. The mutations of D25E and L83V of E6 and N29S of E7 produce new epitopes, and the percentile values change with them. 2017 Immunology letters Abstract HPV D25E;L83V;N29S 17;26;41 21;30;45 E6;E7 34;49 36;51 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. We have previously designed a high affinity bivalent protein binder for the E6 protein, a fusion between a helix from the E6 associated protein and PDZO9, an engineered variant (L391F/K392M) of the second PDZ domain from synapse associated protein 97 (SAP97 PDZ2). 2016 Scientific reports Abstract HPV L391F;K392M 178;184 183;189 E6;E6 76;122 78;124 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. Here we show that an HPV16 E2 Y131A mutant (E2Y131A) had significantly reduced binding to ChlR1 but retained transcriptional activation and viral origin-dependent replication functions. 2017 Journal of virology Abstract HPV Y131A 30 35 E2;E2 27;44 29;46 27801430 HPV16 E6 polymorphism and physical state of viral genome in relation to the risk of cervical cancer in women from the south of Poland. For the first time, missense mutations G122A, C153T and G188A were discovered in EUR-350G variant. 2017 Acta biochimica Polonica Abstract HPV G122A;C153T;G188A 39;46;56 44;51;61 27829177 A naturally occurring variant of HPV-16 E7 exerts increased transforming activity through acquisition of an additional phospho-acceptor site. A common E7 variant encodes an amino acid change at N29S. 2017 Virology Abstract HPV N29S 52 56 E7 9 11 27829177 A naturally occurring variant of HPV-16 E7 exerts increased transforming activity through acquisition of an additional phospho-acceptor site. Biologically, these biochemical differences are reflected in an increased ability of the N29S variant to transform primary rodent cells. 2017 Virology Abstract HPV N29S 89 93 27829177 A naturally occurring variant of HPV-16 E7 exerts increased transforming activity through acquisition of an additional phospho-acceptor site. This is the first study to demonstrate an important biochemical change in E7 function caused by a naturally occurring variation, and we suggest that the N29S variant merits further assessment to determine whether it has an increased association with the development of HPV-associated malignancies. 2017 Virology Abstract HPV N29S 153 157 E7 74 76 HPV-associated cancer 269 296 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. We also found that a lineage B-specific mutation K93R (A379G) was associated with an increased risk of cervical neoplasia. 2016 PloS one Abstract HPV K93R;A379G 49;55 53;60 Cervical carcinoma 103 121 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. 2017 PloS one Abstract HPV K93N;R145I;R145N 0;9;9 4;19;19 E6 60 62 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 In addition, onlyone common variant T234G was identified from all specimens, but it did not lead to any amino acid change. 2017 Asian Pacific journal of cancer prevention Abstract HPV T234G 36 41 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Themost frequently observed variant was C196T in E7 which led to an amino acid change of R66W. 2017 Asian Pacific journal of cancer prevention Abstract HPV C196T;R66W 40;89 45;93 E7 49 51 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 We alsodetected nucleotide variations A86G, and C188T in samples. 2017 Asian Pacific journal of cancer prevention Abstract HPV A86G;C188T 38;48 42;53 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7730C variant which showed a high mutation frequency in cervical cancer was predicted to be a binding site for the cellular transcription factor PHOX2A. 2017 PloS one Abstract HPV A7730C 0 6 Cervical carcinoma 57 72 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7193T and G7521A variants, accounting for 100% of the infections, were predicted to locate at the binding site for FOXA1 and SOX9, respectively. 2017 PloS one Abstract HPV G7193T;G7521A 0;11 6;17 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. A whole-genome sequence signature analysis identified 3 amino acid changes, 16 synonymous nucleotide changes, and a 12-bp insertion strongly associated with the E7 T20I/G63S variant that represents the A3 sublineage and carries higher carcinogenetic potential. 2017 Journal of virology Abstract HPV T20I;G63S 164;169 168;173 E7 161 163 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. The distribution and oncogenic potential of HPV58 variants appear to be heterogeneous, since the E7 T20I/G63S variant is more prevalent in East Asia and confers a 7- to 9-fold-higher risk of cervical precancer and cancer. 2017 Journal of virology Abstract HPV T20I;G63S 100;105 104;109 E7 97 99 Cervical carcinoma 191 209 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. However T389P, located in the H-I loop identified as an immunogenetic region of L1 capsid, was reported in 51.4% of cases could interact with vaccines induced monoclonal antibodies suggesting a potential impact on the efficacy of available anti-HPV vaccines. 2017 Bioinformation Abstract HPV T389P 8 13 L1 80 82 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. Overall, five amino acids residues changes were reported: T390P in 16 specimens, M425I and M431I in 2 cases, insertion of Serine at 460 and aspartic acid deletion at position 477 in all analyzed cases. 2017 Bioinformation Abstract HPV T390P;M425I;M431I 58;81;91 63;86;96 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. The 3D generated model showed that T389P amino acid substitution is located in the H-I loop; the two substitutions M424I and M430I are both located in the H2 helice. 2017 Bioinformation Abstract HPV T389P;M424I;M430I 35;115;125 40;120;130 28968823 Naturally Occurring Single Amino Acid Substitution in the L1 Major Capsid Protein of Human Papillomavirus Type 16: Alteration of Susceptibility to Antibody-Mediated Neutralization. Mean neutralization titers of most variants changed by approximately 4-fold, compared with the reference pseudovirions, with the C428W and K430Q mutations displaying 9-fold and 11-fold lower susceptibilities, respectively, to neutralization by the sera than the reference pseudovirions. 2017 The Journal of infectious diseases Abstract HPV K430Q;C428W 139;129 144;134 28988982 Phylogenetic analysis of Human papillomavirus 16 variants isolated from Indian Breast cancer patients showed difference in genetic diversity with that of cervical cancer isolates. Besides the selection of some common variants in both BC and CACX, some unique variants in BC (D98Y; 395 G>T) and CACX (R48W; 245 G>T) were observed. 2018 Virus research Abstract HPV D98Y;G395T;R48W;G245T 95;101;120;126 99;108;124;133 Breast neoplasms;Cervical carcinoma;Cervical carcinoma;Breast neoplasms 54;61;114;91 56;65;118;93 28988982 Phylogenetic analysis of Human papillomavirus 16 variants isolated from Indian Breast cancer patients showed difference in genetic diversity with that of cervical cancer isolates. The 7521 G>A variant of LCR showed association with Luminal B subtype of BC and progression of CACX. 2018 Virus research Abstract HPV G7521A 4 12 LCR 24 27 Breast neoplasms;Cervical carcinoma 73;95 75;99 28988982 Phylogenetic analysis of Human papillomavirus 16 variants isolated from Indian Breast cancer patients showed difference in genetic diversity with that of cervical cancer isolates. Whereas, 145 G>T (Q14H) and 335 C>T (H78Y) variants of E6 showed association with either early invasiveness of BC and/or poor outcome of the patients. 2018 Virus research Abstract HPV G145T;Q14H;C335T;H78Y 9;18;28;37 16;22;35;41 E6 55 57 Breast neoplasms 111 113 29142126 Human Papillomavirus Replication Regulation by Acetylation of a Conserved Lysine in the E2 Protein. In contrast, the K111 glutamine (K111Q) mutant increased origin melting and stimulated replication compared to wild-type E2. 2018 Journal of virology Abstract HPV K111Q 33 38 E2 121 123 29142126 Human Papillomavirus Replication Regulation by Acetylation of a Conserved Lysine in the E2 Protein. While the replication-defective E2-K111R mutant recruited E1 to the viral replication origin, surprisingly, unwinding of the duplex DNA did not occur. 2018 Journal of virology Abstract HPV K111R 35 40 E2;E1 32;58 34;60 29167339 Identification and Functional Characterization of Phosphorylation Sites of the Human Papillomavirus 31 E8^E2 Protein. However, comparative transcriptome analyses of differentiated HPV31 E8^E2 S78A and S78E cell lines reveal that the expression of a small number of cellular genes is changed. 2018 Journal of virology Abstract HPV S78A;S78E 74;83 78;87 E2 71 73 29393441 Genetic variability in E5, E6, E7 and L1 genes of human papillomavirus type 31. T4053A (F80I), C285T (H60Y), C520T (A138V) and A743G (K62E) were the most common non-synonymous mutations. 2018 Molecular medicine reports Abstract HPV T4053A;F80I;C285T;H60Y;C520T;A138V;A743G;K62E 0;8;15;22;29;36;47;54 6;12;20;26;34;41;52;58 29393441 Genetic variability in E5, E6, E7 and L1 genes of human papillomavirus type 31. The most common non-synonymous mutations of L1 genes were A6350G (T29A) and C6372A (T36N). 2018 Molecular medicine reports Abstract HPV A6350G;T29A;C6372A;T36N 58;66;76;84 64;70;82;88 L1 44 46 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. In the LCR, C7265G and C7266T were the most variable sites and were the potential binding sites for the transcription factor SOX10. 2018 Virology journal Abstract HPV C7265G;C7266T 12;23 18;29 LCR 7 10 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. Six non-synonymous amino acid substitutions (including S71F and K93 N in the E6, and T20I, G41R, G63S/D, and V77A in the E7) were affecting multiple putative epitopes for both CD4+ and CD8+ T-cells. 2018 Virology journal Abstract HPV S71F;K93N;T20I;G41R;G63S;G63D;V77A 55;64;85;91;97;97;109 59;69;89;95;103;103;113 E6;E7 77;121 79;123 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The most common non-synonymous substitution V77A in the E7 was observed in the sequences encoding the alpha-helix. 2018 Virology journal Abstract HPV V77A 44 48 E7 56 58 29787003 HPV16 E6 mutations and p53 codon72 polymorphism among women with cervical intraepithelial neoplasia 2 and 3 in China. CONCLUSION: HPV16 E6 T178G mutation increases the disease risk of CIN2, 3. 2016 European journal of gynaecological oncology Abstract HPV T178G 21 26 E6 18 20 Cervical intraepithelial neoplasia 66 70 29787003 HPV16 E6 mutations and p53 codon72 polymorphism among women with cervical intraepithelial neoplasia 2 and 3 in China. RESULTS: Among the 85 amplified HPV sequences, point mutations such as T178G, T350G, G132A, A442C, T310G, G94T, C551A, etc. 2016 European journal of gynaecological oncology Abstract HPV T178G;T350G;G132A;A442C;T310G;G94T;C551A 71;78;85;92;99;106;112 76;83;90;97;104;110;117 29787003 HPV16 E6 mutations and p53 codon72 polymorphism among women with cervical intraepithelial neoplasia 2 and 3 in China. The rate of HPV16 E6 mutation T178G in CIN2, 3 group was significantly higher than that in normal and CINI group, i.e., in the 112 amplified p53 codon72 sequences, the distribution of Pro/Pro genotype in normal, and CIN1 group was significantly different from that in CIN2, 3 groups, and the disease risk of Pro/Pro genotype was much higher than that of Arg/Arg and Arg/Pro genotypes. 2016 European journal of gynaecological oncology Abstract HPV T178G 30 35 E6 18 20 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 216;39;268 220;43;272 29787003 HPV16 E6 mutations and p53 codon72 polymorphism among women with cervical intraepithelial neoplasia 2 and 3 in China. were found, among which, T178G showed the highest rate (51.76%). 2016 European journal of gynaecological oncology Abstract HPV T178G 25 30 29945151 Genetic Variability in E6 and E7 Oncogenes from Human Papillomavirus Type 58 in Mexican Women. Fifteen new E6 mutations were found; the most frequent were G279T (G57V; 29.78%), T249G (F47C; 34.04%), and A270G (Y54C; 34.04%), and previously reported c307t (63.82%). 2017 Intervirology Abstract HPV G279T;G57V;T249G;F47C;A270G;Y54C 60;67;82;89;108;115 65;71;87;93;113;119 E6 12 14 29945151 Genetic Variability in E6 and E7 Oncogenes from Human Papillomavirus Type 58 in Mexican Women. For E7, 17 known mutations were found, the most frequent were C632T (T20I), 35.30%, G760A (G63S), 35.30%, and t744g 74.50%. 2017 Intervirology Abstract HPV C632T;T20I;G760A;G63S 62;69;84;91 67;73;89;95 E7 4 6 29981762 Genetic variability and lineage phylogeny of human papillomavirus type 45 based on E6 and E7 genes in Southwest China. Eleven nucleotide polymorphism sites were observed in the HPV45 E6 sequences, with 6 synonymous (C134T, T163C, A284C, T341C, T482C, A497G) and 5 non-synonymous (A124C, C157T, T162A, G259T, G487A) mutations. 2018 Virus research Abstract HPV C134T;T163C;A284C;T341C;T482C;A497G;A124C;C157T;T162A;G259T;G487A 97;104;111;118;125;132;161;168;175;182;189 102;109;116;123;130;137;166;173;180;187;194 E6 64 66 29981762 Genetic variability and lineage phylogeny of human papillomavirus type 45 based on E6 and E7 genes in Southwest China. Six nucleotide polymorphism sites were observed in the E7 sequences, with 5 non-synonymous (G600A, A603C, A769C, G808T, G832T) and 1 synonymous (A718C) mutation. 2018 Virus research Abstract HPV G600A;A603C;A769C;G808T;G832T;A718C 92;99;106;113;120;145 97;104;111;118;125;150 E7 55 57 30008422 The association of human papillomavirus type 16 E2 variations with cervical cancer in a Han Chinese population. In the subgroup analysis, the frequency of the T3575G (S274A) variation in the EUR variant was significantly different between the case and control groups (P = 0.029); however, there was no significant difference in the frequency of the variations in the As variant between the case and control groups. 2018 Infection, genetics and evolution Abstract HPV T3575G;S274A 47;55 53;60 30081093 HPV16 E2 variants correlated with radiotherapy treatment and biological significance in cervical cell carcinoma. Amino acid changes T135 K, A143T, N203D and P208A in the amino-terminal region were the most common mutations across the irradiated samples. 2018 Infection, genetics and evolution Abstract HPV T135K;A143T;N203D;P208A 19;27;34;44 25;32;39;49 30081093 HPV16 E2 variants correlated with radiotherapy treatment and biological significance in cervical cell carcinoma. Rather, the mutations in the carboxy-terminal region (T3694A and T3805G) were synonymous changes. 2018 Infection, genetics and evolution Abstract HPV T3694A;T3805G 54;65 60;71 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. A7874C, which lies within an E2-binding sequence, is also shown to increase the activity and binding of E2 at this site. 2018 Scientific reports Abstract HPV A7874C 0 6 E2;E2 29;104 31;106 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, the three variations most active in HeLa cells were C7537A, A7874C and A7879G. 2018 Scientific reports Abstract HPV C7537A;A7874C;A7879G 65;73;84 71;79;90 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Remarkably, the two variations with the greatest effect on the EP in PHK were C7732G and a 79-bp deletion that were associated with high-grade cervical lesions and persistent infections, respectively, in epidemiological studies. 2018 Scientific reports Abstract HPV C7732G 78 84 Cervical lesions 143 159 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. INTERPRETATION & CONCLUSIONS: This study showed a predominance of European lineage variants of HPV16 among asymptomatic women from Sinaloa, Mexico, predominantly with of the E350G variant. 2018 The Indian journal of medical research Abstract HPV E350G 174 179 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. It was further observed that the E350G intra-variant was the most common (>76%). 2018 The Indian journal of medical research Abstract HPV E350G 33 38 30471332 Genetic variability and oncogenic risk association of human papillomavirus type 58 E6 and E7 genes in Taizhou area, China. The sublineage A3 variants with T20I/G63S substitutions at E7 oncoprotein carried a significantly higher risk for high-grade cervical intraepithelial neoplasia (CIN2 or worse, CIN2+) when compared with other HPV58 variants (odds ratio = 4.41, P < 0.05). 2019 Gene Abstract HPV T20I;G63S 32;37 36;41 E7 59 61 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 114;161;176 159;165;180 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Among them, the T20I/G63S variant (V1) had a stronger epidemiological association with cervical cancer. 2019 Journal of cellular and molecular medicine Abstract HPV T20I;G63S 16;21 20;25 Cervical carcinoma 87 102 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Previously, we identified the three most common circulating HPV58 E7 strains contained amino acid alterations: G41R/G63D (51%), T20I/G63S (22%) and T74A/D76E (14%) respectively. 2019 Journal of cellular and molecular medicine Abstract HPV G41R;G63D;T20I;G63S;T74A;D76E 111;116;128;133;148;153 115;120;132;137;152;157 E7 66 68 30578936 Identification of human papillomavirus type 16 variants circulating in the Calabria region by sequencing and phylogenetic analysis of HPV16 from cervical smears. The most common SNP was the T350G (29/39 samples, 74.4%), causing the L83 V amino acid change in the E6. 2019 Infection, genetics and evolution Abstract HPV T350G;L83V 28;70 33;75 E6 101 103 30583025 Genetic variability of human papillomavirus type 51 E6, E7, L1 and L2 genes in Southwest China. 13 nucleotide polymorphism sites were observed in E6-E7 gene and the most common mutation sites were C395T (S100L), C756T (S66L), C796T, A832G. 2019 Gene Abstract HPV C395T;C756T;S66L;C796T;A832G;S100L 101;116;123;130;137;108 106;121;127;135;142;113 E6;E7 50;53 52;55 30583025 Genetic variability of human papillomavirus type 51 E6, E7, L1 and L2 genes in Southwest China. 36 nucleotide polymorphism sites were identified in full length L1 gene and the non-synonymous mutations T6311G, A6312T (V264G), G6313A (G265S) A5674C (I52L), A6335C (N272T), A6586C (T354P) and synonymous mutations A5649T, C6147T, A6435G, G6570A, A6651G, T6774C, A6784C, A6882G, C6918A, and G6984A were the most common mutations. 2019 Gene Abstract HPV T6311G;A6312T;V264G;G6313A;G265S;A5674C;I52L;A6335C;N272T;A6586C;T354P;A5649T;C6147T;A6435G;G6570A;A6651G;T6774C;A6784C;A6882G;C6918A;G6984A 105;113;121;129;137;144;152;159;167;175;183;215;223;231;239;247;255;263;271;279;291 111;119;126;135;142;150;156;165;172;181;188;221;229;237;245;253;261;269;277;285;297 L1 64 66 30583025 Genetic variability of human papillomavirus type 51 E6, E7, L1 and L2 genes in Southwest China. Besides, the non-synonymous mutations G4227A (V32I), A4407G (I92V), G4945A (D271N), C4985A (T284K), T5260G (L376V), A5335C (T401P) and the synonymous mutations A4166G, G4229A, G4283A, T4453C, C4566A, T4596C, C4695T, C4830T, G4839A, A5160C, and T5286G were the most common mutations. 2019 Gene Abstract HPV G4227A;V32I;A4407G;I92V;G4945A;D271N;C4985A;T284K;T5260G;L376V;A5335C;T401P;A4166G;G4229A;G4283A;T4453C;C4566A;T4596C;C4695T;C4830T;G4839A;A5160C;T5286G 38;46;53;61;68;76;84;92;100;108;116;124;160;168;176;184;192;200;208;216;224;232;244 44;50;59;65;74;81;90;97;106;113;122;129;166;174;182;190;198;206;214;222;230;238;250 30583025 Genetic variability of human papillomavirus type 51 E6, E7, L1 and L2 genes in Southwest China. Specially, a triallelic mutation site (G4461C/A) in L2 was identified, with 26% G4461C (E109D) being non-synonymous mutation. 2019 Gene Abstract HPV G4461C;G4461A;G4461C;E109D 39;39;80;88 47;47;86;93 L2 52 54 30654371 The HPV16 E1 Carboxyl Domain Provides a Helper Function for Adeno-Associated Virus Replication. METHODS: Rep78-E1 interaction was analyzed by Gal4-based yeast two-hybrid (Y2H)-cDNA assay. 2018 Intervirology Abstract HPV Y2H 75 78 E1 15 17 30654371 The HPV16 E1 Carboxyl Domain Provides a Helper Function for Adeno-Associated Virus Replication. RESULTS: Gal4-Y2H- cDNA assay found in vivo Rep78-E1-binding activity across E1, but the carboxyl-third (amino acids [aa] 421-649) of E1 contained the predominant DNA replication helper domain. 2018 Intervirology Abstract HPV Y2H 14 17 E1;E1;E1 50;77;134 52;79;136 30676312 Oncogenicitiy Comparison of Human Papillomavirus Type 52 E6 Variants. In the present study, we compared the oncogenicity of E6 derived from the HPV-52 prototype and three commonly found variants, V1 (K93R), V2 (E14D/V92L) and V3 (K93R/N122K), through molecular and phenotypic approaches. 2019 The Journal of general virology Abstract HPV K93R;V92L;E14D;K93R;N122K 130;146;141;160;165 134;150;145;164;170 E6 54 56 30842331 Phosphorylation of a Conserved Tyrosine in the Papillomavirus E2 Protein Regulates Brd4 Binding and Viral Replication. Interestingly, the Y138E protein coimmunoprecipitated with full-length Brd4 but was defective for association with its C-terminal domain (CTD). 2019 Journal of virology Abstract HPV Y138E 19 24 30842331 Phosphorylation of a Conserved Tyrosine in the Papillomavirus E2 Protein Regulates Brd4 Binding and Viral Replication. The E2 phenylalanine (F) mutant Y138F displayed reduced FGFR3-induced phosphotyrosine. 2019 Journal of virology Abstract HPV Y138F 32 37 E2 4 6 30842331 Phosphorylation of a Conserved Tyrosine in the Papillomavirus E2 Protein Regulates Brd4 Binding and Viral Replication. The tyrosine to glutamic acid (E) mutant Y138E, which can mimic phosphotyrosine, failed to induce transient DNA replication, although it maintained the ability to bind and localize the viral DNA helicase E1 to the viral origin. 2019 Journal of virology Abstract HPV Y138E 41 46 E1 204 206 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C abrogated binding of recombinant C/EBPbeta to this site in vitro and stimulated the EP in vivo, suggesting that it abrogates a negatively-acting regulatory element. 2019 Scientific reports Abstract HPV T7791C 0 6 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. This increased promoter activity was ascribed to a single nucleotide variation in the LCR, T7791C, in a putative binding site for the transcription factor C/EBPbeta. 2019 Scientific reports Abstract HPV T7791C 91 97 LCR 86 89 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. A total of 33 polymorphic sites were found in the LCR, of which T7447C (39/95, 40.1%) was the most frequent. 2019 Cancer cell international Abstract HPV T7447C 64 70 LCR 50 53 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In the E7 gene, the locus with the highest mutation frequency was A647G (18/75, 24%). 2019 Cancer cell international Abstract HPV A647G 66 71 E7 7 9 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Results: Fourteen missense mutations were found in the E6 gene; the loci with the highest mutation frequency were T350G (36/75, 48%) and T178G (19/75, 25.3%). 2019 Cancer cell international Abstract HPV T350G;T178G 114;137 119;142 E6 55 57 30981880 Human papillomavirus type 16 E6 and E7 gene variations associated with cervical cancer in a Han Chinese population. However, the distribution of C749T (S63F) in the E7 gene was significantly different between the case and control groups for the A4 (As) and A1-A3 (EUR) sub-lineages (P = 1.815 x 10-8 and P = 0.008). 2019 Infection, genetics and evolution Abstract HPV C749T;S63F 29;36 34;40 E7 49 51 30981880 Human papillomavirus type 16 E6 and E7 gene variations associated with cervical cancer in a Han Chinese population. In the current study, we found that the C749T (S63F) variation in the HPV16 E7 gene was associated with cervical cancer not only in the A4 (As) sub-lineage but also in the A1-A3 (EUR) sub-lineage. 2019 Infection, genetics and evolution Abstract HPV C749T;S63F 40;47 45;51 E7 76 78 Cervical carcinoma 104 119 30981880 Human papillomavirus type 16 E6 and E7 gene variations associated with cervical cancer in a Han Chinese population. When the distribution of the HPV16 E6 and E7 gene variations was compared, the distribution of only A131C (R10R) in the E6 gene showed a different trend between the case and control groups and C749T (S63F) in the E7 gene was significantly different between the case and control groups (P = 0.071 and P = 4.861 x 10-10, respectively). 2019 Infection, genetics and evolution Abstract HPV R10R;A131C;C749T;S63F 107;100;193;200 111;105;198;204 E6;E6;E7;E7 35;120;42;213 37;122;44;215 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. In the analysis of the HPV11 samples, all patients showed the mutations T137C and (cytosine) C380T. 2019 Advances in virology Abstract HPV T137C;C380T 72;93 77;98 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. One patient also presented the nucleotide alteration T410C. 2019 Advances in virology Abstract HPV T410C 53 58 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. Twelve samples were identified as the HPV6B3 variant, presenting the mutation (guanine) G474A (adenine), and one of them also showed the mutation (thymine) T369G. 2019 Advances in virology Abstract HPV G474A;T369G 88;156 93;161 31299490 HPV8 activates cellular gene expression mainly through Sp1/3 binding sites. Interestingly, the HPV8-E7L23A mutant, which cannot trigger keratinocyte invasion was unable to activate fibronectin gene expression. 2019 Virology Abstract HPV L23A 26 30 E7 24 26 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. In the sub-lineage analysis, the differences in the T933A (A23A), T1014G (D50E) and G2160A (R432R) mutations were statistically significant between the case and control groups for the A4 (As) sub-lineage (P<0.05), and the differences in the T2232C (F456F), G2337A (M491I) and A2547G (P561P) mutations were statistically significant between the case and control groups for the A1-A3 (EUR) sub-lineage (P<0.05). 2019 International journal of medical sciences Abstract HPV T933A;T1014G;D50E;G2160A;R432R;T2232C;F456F;G2337A;M491I;A2547G;P561P;A23A 52;66;74;84;92;241;249;257;265;276;284;59 57;72;78;90;97;247;254;263;270;282;289;63 31493439 Distribution of HPV 16 E6 gene variants in screening women and its associations with cervical lesions progression. Interestingly, in patients with suspected cervical lesions the most prevalent variant was As variant (54.9%) by increasing significance with severity of cervical diseases (OR 4.337; 95% CI 1.248-15.067; P = 0.021), and followed by HPV 16 E-p variant while E-G350 variant only appeared in HSIL and cervical cancer. 2019 Virus research Abstract HPV E-G350 256 262 Cervical lesions;Cervical diseases;Cervical carcinoma;Squamous intraepithelial lesions 42;153;297;288 58;170;312;292 31493439 Distribution of HPV 16 E6 gene variants in screening women and its associations with cervical lesions progression. The HPV 16 variants were determined by sequencing parital E6 region and the detected variants were European prototype E-T350 (E-p), E-G350, E-C109 G, Asian (As) and Asian-American (AA), among which the E-p variant was the most prevalent (82.76%) followed by As variant. 2019 Virus research Abstract HPV C109G;E-T350;E-G350 140;118;132 148;124;138 E6 58 60 31552532 Mutational landscape and intra-host diversity of human papillomavirus type 16 long control region and E6 variants in cervical samples. Moreover, the most frequent mutations, both in samples from this study and in the available sequences from Mexican isolates in the GenBank database were LCR-G7518A, which is involved in carcinogenesis, and E6-T350G (producing L83V), associated with persistence of infection. 2019 Archives of virology Abstract HPV G7518A;T350G;L83V 157;209;226 163;214;230 E6;LCR 206;153 208;156 31670402 Genetic variability and functional implication of HPV16 from cervical intraepithelial neoplasia in Shanghai women. 6329G>T, a potential binding site for TATA-binding protein, is the most common in LCR variants. 2020 Journal of medical virology Abstract HPV G6329T 1 8 31670402 Genetic variability and functional implication of HPV16 from cervical intraepithelial neoplasia in Shanghai women. Amino acid substitutions (D32N/E, E36Q, H85Y, and E120D in E6 and N29H/S and R77C in E7) were predicted to have an effect on conserved structural and functional residues, and five amino acid substitutions (H85Y, E36Q, I34L, and D32E in E6; R77C in E7) would potentially change the secondary structure. 2020 Journal of medical virology Abstract HPV D32N;D32E;E36Q;H85Y;N29H;N29S;R77C;H85Y;E36Q;I34L;D32E;R77C;E120D 26;26;34;40;66;66;77;206;212;218;228;240;50 32;32;38;44;72;72;81;210;216;222;232;244;55 E6;E7;E6;E7 59;85;236;248 61;87;238;250 31670402 Genetic variability and functional implication of HPV16 from cervical intraepithelial neoplasia in Shanghai women. The H85Y and E120D variants in E6 were significantly reduced in the high-grade squamous intraepithelial lesion (HSIL) group compared to the A) and the other had one silent mutation at position 796 (T --> C). 1997 Gynecologic oncology Abstract HPV G666A;T796C 47;111 60;124 9264576 Major sequence variants in E7 gene of human papillomavirus type 16 from cervical cancerous and noncancerous lesions of Korean women. The second most common variant, found in 16.7% of cases, had three silent mutations at positions 732 (T --> C), 789 (T --> C), and 795 (T --> G). 1997 Gynecologic oncology Abstract HPV T732C;T789C;T795G 97;112;131 110;125;144 9264576 Major sequence variants in E7 gene of human papillomavirus type 16 from cervical cancerous and noncancerous lesions of Korean women. The variant with a single nucleotide change at position 647 (A --> G, Asn --> Ser) was found in about 60% of DNA samples with HPV 16. 1997 Gynecologic oncology Abstract HPV A647G 56 69 9733858 A fifteen-amino-acid peptide inhibits human papillomavirus E1-E2 interaction and human papillomavirus DNA replication in vitro. Mutation of the conserved glutamic acid residue at position 39 of human papillomavirus type 16 (HPV-16) E2 to alanine (E39A) disrupts its E1 interaction activity and its replication function in transient replication assays but does not affect E2 transcriptional activation. 1998 Journal of virology Abstract HPV E39A 119 123 E1;E2;E2 138;104;243 140;106;245 9733858 A fifteen-amino-acid peptide inhibits human papillomavirus E1-E2 interaction and human papillomavirus DNA replication in vitro. This E39A mutation also disrupts replication activity of HPV-16 E2 in HPV-16 in vitro DNA replication. 1998 Journal of virology Abstract HPV E39A 5 9 E2 64 66 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. This E6 variant showed an amino acid change from leucine to valine at residue 83 (L83V). 2002 British journal of cancer Introduction HPV L83V;L83V 82;49 86;80 E6 5 7 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Mutation of lysine 292 to arginine eliminated sumoylation, indicating that this amino acid was the major sumoylation target site. 2008 Virology Introduction HPV K292R 12 34 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. We showed that C92A E2-25K, the catalytic site dominant negative mutant E2 efficiently blocked proteolysis of Rb by E7 suggesting that the ubiquitin carrier protein E2-25K supports E7-induced proteolysis of Rb. 2010 Virology Introduction HPV C92A 15 19 E2;E2;E2;E7;E7 20;72;165;116;181 22;74;167;118;183 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. In a previous study we investigated the functional characteristics of L83V-related E6 variants that are highly represented in cervical cancers, including the Asian-American Q14H/H78Y/L83V variant. 2011 Molecular cancer Introduction HPV L83V;L83V;Q14H;H78Y 70;183;173;178 74;187;177;182 E6 83 85 Cervical carcinoma 126 142 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. These include the R8Q, identified in one high-grade lesion of a Finnish woman, R10G, identified in two cervical carcinomas of Swedish women and R48W identified in one cervical carcinoma of an Italian woman. 2011 Molecular cancer Introduction HPV R8Q;R10G;R48W 18;79;144 21;83;148 Cervical carcinoma;Cervical carcinoma 103;167 122;185 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Three rare variants were characterized for their functional abilities in assays relevant to carcinogenesis when compared to a common variant in cervical cancer of European women, namely L83V. 2011 Molecular cancer Introduction HPV L83V 186 190 Cervical carcinoma 144 159 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Several studies on the L83V variant have demonstrated an association with viral persistence and cancer progression of cervical carcinoma, although some later studies have failed to confirm this association. 2012 PloS one Introduction HPV L83V 23 27 Cervical carcinoma 118 136 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The most frequent of these mutations is the T to G transition at nt 350 in E6, abbreviated as E-T350G, causing an amino acid change from leucine to valanine at a.a. 2012 PloS one Introduction HPV T350G;T350G 44;96 71;101 E6 75 77 22571619 Human papillomavirus type 58: the unique role in cervical cancers in East Asia. The first amino acid substitution (T20I) is close to the Leu-Xaa-Cys-Xaa-Glu domain that mediates association with the retinoblastoma protein (pRb) and its related proteins, p107 and p130. 2012 Cell & bioscience Introduction HPV T20I 35 39 22571619 Human papillomavirus type 58: the unique role in cervical cancers in East Asia. The substitution G63S results in a serine which could be phosphorylated by casein kinase II, and a positive association between phosphorylation rate and oncogenic potential of E7 has been reported. 2012 Cell & bioscience Introduction HPV G63S 17 21 E7 176 178 22571619 Human papillomavirus type 58: the unique role in cervical cancers in East Asia. This variant harboring two amino acid substitutions, T20I and G63S, in the E7 protein was found to associate with an odds ratio of 10.14 (95% confidence interval = 10.14-74.72) for the development of cervical cancer, which was 6.9-fold higher than HPV58 variants without these sequence variations. 2012 Cell & bioscience Introduction HPV T20I;G63S 53;62 57;66 E7 75 77 Cervical carcinoma 200 215 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. Furthermore, all samples containing the E1-1374 63nt duplication belonged to the commonly reported E-G350 (E6-350G or L83V) variants. 2012 PloS one Introduction HPV L83V 118 122 E1;E6 40;107 42;109 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. The HPV16 AA lineage variant and the EUR T350G (L83V) variant exhibit an increased propensity to transform primary human foreskin keratinocytes or induce apoptosis in organotypic raft cultures in vitro compared to the HPV16 prototype. 2014 Infection, genetics and evolution Introduction HPV T350G;L83V 41;48 46;52 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Within the EUR variant lineage, a T350G substitution in the E6 gene leads to an altered amino acid residue (L83V) and has been associated with HPV16 persistence and cervical disease, though not in all cases. 2014 Infection, genetics and evolution Introduction HPV T350G;L83V 34;108 39;112 E6 60 62 Cervical diseases 165 181 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. Also, at both 10 and 20 days, C161S and C379S virions are less infectious than wild-type virions. 2014 PloS one Introduction HPV C161S;C379S 30;40 35;45 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C229S virions are completely non-infectious. 2014 PloS one Introduction HPV C229S 0 5 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. Further, C161S, C229S, and C379S mutant virions are less stable than wild-type virions. 2014 PloS one Introduction HPV C161S;C229S;C379S 9;16;27 14;21;32 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. We found that after 10 and 20 days of tissue growth, C161S, C229S, and C379S virions produce lower viral titers compared to wild-type virions. 2014 PloS one Introduction HPV C161S;C229S;C379S 53;60;71 58;65;76 25483514 Anti-tumor effects of genetic vaccines against HPV major oncogenes. Our previous data have demonstrated the induction of antitumor activity in a safe setting by vaccines based on two mutated, non-transforming forms of HPV16 E7 (E7GGG) and E6 (E6F47R) (De Giuli Morghen, Personal Communication). 2015 Human vaccines & immunotherapeutics Introduction HPV F47R 177 181 E6;E6;E7 171;175;156 173;177;158 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. An in-vivo single-point E6 mutant of HPV-16, E6F47R, has also been identified as defective for polyubiquitination and degradation of p53, which competes with the endogeneous E6. 2015 Journal of translational medicine Introduction HPV F47R 47 51 E6;E6;E6 24;45;174 26;47;176 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. By hampering the p53 degradation both in vitro and in vivo, E6F47R changes the E6 oncoprotein into a suppressor of proliferation of HPV-positive HeLa cells. 2015 Journal of translational medicine Introduction HPV F47R 62 66 E6;E6 60;79 62;81 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The aim of the present study was to generate preventive/therapeutic DNA-based and FP-based recombinant vaccines that express the modified HPV-16 E6F47R gene, and to determine their immunogenicity and efficacy by different prime/boost immunization protocols. 2015 Journal of translational medicine Introduction HPV F47R 147 151 E6 145 147 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Other polymorphisms including A131G, G132C, C143G, G145T, G176A, T178G and C335T generate the amino acid changes R10G/I, Q14H/D, D25E/N, I27R and H78Y, respectively. 2015 Virology journal Introduction HPV R10I;A131G;G132C;C143G;G145T;G176A;T178G;C335T;R10G;Q14H;Q14D;D25E;D25N;I27R;H78Y 113;30;37;44;51;58;65;75;113;121;121;129;129;137;146 119;35;42;49;56;63;70;80;119;127;127;135;135;141;150 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Several reports have shown the presence of common polymorphisms that generate amino acid changes in the E6 oncoprotein, one of them is T350G, and is present in the four lineages. 2015 Virology journal Introduction HPV T350G 135 140 E6 104 106 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. T350G causes a leucine to valine change (L83V), that leads to the split of the EUR sublineage into three classes, 350 T (prototype sequence), 350C and 350G. 2015 Virology journal Introduction HPV T350G;L83V 0;41 5;45 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. Further, a large body of experimental research on the differential biological activities of HPV16 variants has focused on the E6 gene, especially on the T350G polymorphism, corresponding to the L83V amino acid substitution in the E6 oncoprotein. 2016 Cancer medicine Introduction HPV T350G;L83V 153;194 158;198 E6;E6 126;230 128;232 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. However, the T350G polymorphism is found in different HPV16 variant lineages and is not a specific marker of any of them 16. 2016 Cancer medicine Introduction HPV T350G 13 18 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. Particularly, the E6 T350G polymorphism has been associated with differential persistence and risk of progression to precancerous cervical lesions 17, 18. 2016 Cancer medicine Introduction HPV T350G 21 26 E6 18 20 Cervical lesions 130 146 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. We aimed to analyze the differential prevalence of HPV16 variants as well as of the intensively studied T350G polymorphism as a function of the anatomical location of the lesion, the geographical origin of the samples, and the age at cancer diagnosis. 2016 Cancer medicine Introduction HPV T350G 104 109 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. PDZO9, in turn, was selected from a library of pWT PDZ2 variants using phage display and it carries two additional mutations as compared to pWT PDZ2, L391F and K392M. 2016 Scientific reports Introduction HPV L391F;K392M 150;160 155;165 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. pWT PDZ2 has two mutations as compared to wild type SAP97 PDZ2 (I342W and C378A) and is the variant used in our previous studies on the binding of SAP97 PDZ2. 2016 Scientific reports Introduction HPV I342W;C378A 64;74 69;79 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. The L391F mutation is located in the p0 hydrophobic binding pocket, and is expected to make direct contacts with bound peptide. 2016 Scientific reports Introduction HPV L391F 4 9 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. In a multicontinental epidemiological study, the HPV58 E7 T20I/G63S variant was more frequently detected in East Asia and carried a 7- to 9-fold-higher risk for cervical cancer, indicating that the viral variant plays a key role in modulating its unique carcinogenic property. 2017 Journal of virology Introduction HPV G63S;T20I 63;58 67;62 E7 55 57 Cervical carcinoma 161 176 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In this manuscript, we used luciferase reporter-gene assays to characterize the EP activity of different HPV33 variants containing 79del and/or C7732G and spanning the worldwide diversity of the virus. 2018 Scientific reports Introduction HPV C7732G 144 150 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Our own clinical investigations revealed that HPV33 variants lacking one copy of a tandemly duplicated 79-bp sequence (79del) unique to the HPV33 LCR are associated with persistence of the infection, while those containing a C to G transversion at position 7732 (C7732G) of the LCR are linked to the development of high-grade squamous intraepithelial lesions (HSIL), two risk factors for progression to cervical cancer. 2018 Scientific reports Introduction HPV C7732G;79del;C7732G 263;119;225 269;124;261 LCR;LCR 146;278 149;281 Squamous intraepithelial lesions;Squamous intraepithelial lesions;Cervical carcinoma 315;360;403 358;364;418 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Concordant with our previous finding, the HPV58 E7 V1 (T20I/G63S) variant conferred a significantly higher risk for CIN III and ICC (odds ratio: 4.44, P = 0.007) compared to other HPV58 E7 variants.27 . 2019 Journal of cellular and molecular medicine Introduction HPV T20I;G63S 55;60 59;64 E7;E7 48;186 50;188 Cervical intraepithelial neoplasia;Cervical carcinoma 116;128 123;131 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Concordant with our previous finding, the HPV58 E7 V1 (T20I/G63S) variant conferred a significantly higher risk for CIN III and ICC (odds ratio: 4.44, P = 0.007) compared to other HPV58 E7 variants.27. 2019 Journal of cellular and molecular medicine Introduction HPV G63S;T20I 60;55 64;59 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Therefore, this study aimed to investigate the comparative oncogenic properties of HPV58 E7 prototype and its variants, particularly the E7 T20I/G63S (V1), using a series of phenotypic and molecular assays. 2019 Journal of cellular and molecular medicine Introduction HPV G63S;T20I 145;140 149;144 E7;E7 89;137 91;139 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. To remedy this lack, we carried out an epidemiological study on 1924 Hong Kong women and identified an HPV58 variant (E7 T20I/G63S, designated as V1) conferring an odds ratio of 26.8 for cervical intraepithelial neoplasia (CIN) III or SCC.25 This epidemiological association was subsequently reproduced by an independent research group from Zhejiang province, East China.26 . 2019 Journal of cellular and molecular medicine Introduction HPV T20I;G63S 121;126 125;130 E7 118 120 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 187;223 221;226 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. To remedy this lack, we carried out an epidemiological study on 1924 Hong Kong women and identified an HPV58 variant (E7 T20I/G63S, designated as V1) conferring an odds ratio of 26.8 for cervical intraepithelial neoplasia (CIN) III or SCC.25 This epidemiological association was subsequently reproduced by an independent research group from Zhejiang province, East China.26. 2019 Journal of cellular and molecular medicine Introduction HPV G63S;T20I 126;121 130;125 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. We then expanded our epidemiological study to an international scale, using 401 HPV58-containing clinical samples collected from 15 locations across four continents.24 We found that the three most common circulating HPV58 E7 strains contained the amino acid alterations: G41R/G63D (51%), T20I/G63S (V1; 22%) and T74A/D76E (14%) respectively.27 HPV58 E7 prototype. 2019 Journal of cellular and molecular medicine Introduction HPV G63D;G41R;T20I;G63S;T74A;D76E 276;271;288;293;312;317 280;275;292;297;316;321 E7;E7 222;350 224;352 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. With this background, we suggested that the E7 T20I/G63S (V1) variant of HPV58 might possess a stronger oncogenicity than the other HPV58 E7 variants. 2019 Journal of cellular and molecular medicine Introduction HPV T20I;G63S 47;52 51;56 E7;E7 44;138 46;140 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In further support of this notion, we observed that the C7732G variation that is present in some A2-sublineage variants and which we previously found to be associated with high grade squamous intraepithelial lesion (HSIL), also increases the activity of the HPV33 EP approximately 2-fold in PHK. 2019 Scientific reports Introduction HPV C7732G 56 62 Squamous intraepithelial lesions;Squamous intraepithelial lesions 172;216 214;220 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Our results indicate that the higher EP activity of LCR10 in transformed cell lines is due to a single nucleotide variation, T7791C, which abrogates a binding site for C/EBPbeta that represses the EP. 2019 Scientific reports Introduction HPV T7791C 125 131 LCR 52 55 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. These results indicate that the HPV33 EP is regulated negatively and positively by C/EBPbeta via two distinct regulatory elements, and that T7791C results in derepression of the promoter. 2019 Scientific reports Introduction HPV T7791C 140 146 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. reported that the A1668G, G2073A, T2169C, T2189C, A2453T, C2454T, A2587T and G2650A mutations of HPV16 E1 were identified only in high-grade dysplasia cases in a Greek population, and this result indicated that those mutations may play an important role in cervical carcinogenesis. 2019 International journal of medical sciences Introduction HPV A1668G;G2073A;T2169C;T2189C;A2453T;C2454T;A2587T;G2650A 18;26;34;42;50;58;66;77 24;32;40;48;56;64;72;83 E1 103 105 High-grade dysplasia;Cervical diseases 130;257 150;280 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. For example, the T variation of the E6 gene T350G (L83V) persisted more often than the G variation in the EUR sub-lineage. 2020 International journal of medical sciences Introduction HPV T350G;L83V 44;51 49;55 E6 36 38 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. We then combine L1 proteins bearing C175A or C428A mutations in solution, and found a recovery of particle formation through reciprocal assembly (i.e., C175A and C428A L1 proteins bind through their unmutated cysteine residues). 2020 Nature communications Introduction HPV C175A;C428A;C175A;C428A 36;45;152;162 41;50;157;167 L1;L1 16;168 18;170 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. However, only the N29S variant has been related to a significant oncogenic potential due to an additional phosphorylation site compared to the E7 reference. 2021 International journal of molecular sciences Introduction HPV N29S 18 22 E7 143 145 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. These changes are epidemiologically related to the oncogenicity of the virus in different populations, where variants G647 (N29S) and A712 (H51N) have been found to be most frequently associated with CC. 2021 International journal of molecular sciences Introduction HPV H51N;N29S 140;124 144;128 Cervical carcinoma 200 202 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. E2 recruits TopBP1 onto mitotic chromatin and results in increased expression of both proteins during this period of the cell cycle, the E2 S23A mutant fails to increase either TopBP1 or E2 protein levels during mitosis. 2021 mBio Introduction HPV S23A 140 144 E2;E2;E2 0;137;187 2;139;189 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. E2-S23A (an alanine substitution at position serine 23 which is defective in TopBP1 interaction) and E2-WT (wild-type E2) have similar transcription and replication functions in our transient assays. 2021 mBio Introduction HPV S23A 3 7 E2;E2;E2 0;101;118 2;103;120 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Introduction of the E2-S23A mutation into the HPV16 genome results in a delay in human foreskin keratinocyte (HFK) immortalization compared with the wild-type genome. 2021 mBio Introduction HPV S23A 23 27 E2 20 22 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. For example, L83V (L90V) of HPV-16 E6 in Swedish and Italian populations as well as D25E (D32E) of HPV-16 E6 in Japanese populations have been proven to be associated with the progression of cervical cancer. 2022 Virology journal Introduction HPV D32E;L83V;L90V;D25E 90;13;19;84 94;17;23;88 E6;E6 35;106 37;108 Cervical carcinoma 191 206 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. In order to mitigate competition for the presentation of HLA-A2-restricted E7-specific cytotoxic CTL epitopes (e.g., aa 11 to 20) in HLA-A2 (AAD) transgenic mice, we tested a modified DNA vaccine construct encoding CRT linked to a mutated E7(N53S) gene: CRT/E7(N53S). 2022 mBio Introduction HPV N53S;N53S 242;261 246;265 E7;E7;E7 75;239;258 77;241;260 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Thus, here we have constructed double mutant E6 by replacing the amino acid arginine (R) with lysine (K) at location 55 (R55K), with additional deletion of the lysine (K) at location 75 (delK75). 2022 mBio Introduction HPV R55K 121 125 E6 45 47 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. We found that C57BL/6 mice vaccinated with DNA vaccine encoding CRT linked to mutated E6(R55K)(delK75) completely abolished the murine MHC-restricted HPV16 E6-specific CD8+ T cell-mediated immune responses. 2022 mBio Introduction HPV R55K 89 93 E6;E6 86;156 88;158 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. We found that HLA-A2 (AAD) mice vaccinated with CRT/E7(N53S) DNA via in vivo EP elicited potent HLA-A2-restricted E7 peptide (aa 11 to 20)-specific CD8+ T cell-mediated immune responses, suggesting this mutation mitigated competition from H-2Db-restricted presentation. 2022 mBio Introduction HPV N53S 55 59 E7;E7 52;114 54;116 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. We further tested the mutated E7(N53S) and mutated E6(R55K)(delK75) for their ability to generate spontaneous oral/pharyngeal cancer using a similar approach, as we described previously. 2022 mBio Introduction HPV N53S;R55K 33;54 37;58 E6;E7 51;30 53;32 Oral/pharyngeal tumor 110 132 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. The variants E-G350 (L83V), E-C188/G350 (E29Q/L83V), E-A176/G350 (D25N/L83V), AAa (D25N/L83V), and AAc (Q14H/I27R/H78Y/L83V) were found to be the most prevalent in a population from Guerrero, Mexico, a state with the highest poverty and marginalization rates in the country. 2022 Scientific reports Introduction HPV L83V;E29Q;L83V;L83V;D25N;L83V;D25N;L83V;Q14H;I27R;H78Y 21;41;46;71;66;88;83;119;104;109;114 25;45;50;75;70;92;87;123;108;113;118 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. T178G is the most common polymorphic mutation in Asian strains, which causes aspartate to change to glutamine (D25E). 2022 Cancer cell international Introduction HPV D25E;T178G 111;0 115;5 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. T350G is the most common polymorphic mutation in European strains, which causes leucine to change to proline (L83V). 2022 Cancer cell international Introduction HPV T350G;L83V 0;110 5;114 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). The p6xE2BS-Luc or pHPV18LCR-Luc plasmids were co-transfected with the pSV-beta-Galactosidase control vector (Promega) and the E2 plasmids (wildtype or K292R mutant) using Lipofectamine 2000. 2008 Virology Method HPV K292R 152 157 E2 127 129 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. We have chosen four HPV16 E6 species, which had previously been detected in clinical samples from Scandinavian women: the European species E6 prototype, L83V and R10G/L83V as well as the Asian-American variant Q14H/H78Y/L83V. 2009 Virology Method HPV L83V;R10G;L83V;L83V;Q14H;H78Y 153;162;167;220;210;215 157;166;171;224;214;219 E6;E6 26;139 28;141 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. E6-1 was preamplified in PCR1 mixtures with the LCRS/E7AS primer pair and E6-2 in PCR2 mixtures with the internal E6F/PU-2R16 primer pair. 2009 Infectious agents and cancer Method HPV E6F 114 117 LCR;E6;E6 48;0;74 51;2;76 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The E6-1 product (~650 bp) was preamplified with the LCRS/E7AS primer pair in the first reaction (PCR1), and the E6-2 product (~626 bp) with the E6F/PU-2R16 primer pair in the second reaction (PCR2). 2009 Infectious agents and cancer Method HPV E6F 145 148 LCR;E6;E6 53;4;113 56;6;115 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The variation in R8Q hindered recognition by the anti HPV16 E6 clone 6F-4. 2011 Molecular cancer Method HPV R8Q 17 20 E6 60 62 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. We have chosen four HPV16 E6 variants, which had previously been detected in clinical samples from Swedish, Finnish and Italian women: the European R8Q, R48W, R10G and L83V. 2011 Molecular cancer Method HPV R8Q;R10G;R48W;L83V 148;159;153;168 151;163;157;172 E6 26 28 23609590 Human papillomavirus prevalence in invasive anal cancers in the United States before vaccine introduction. Subsequently, nucleotide identities at position 109, 131, 132, 143, 145, 178, 350 were determined with a Pyromark Q96 MD (Qiagen, Valencia, CA, USA) to identify the variants AA/NA-1, Af1, Af2, As, E-C109G, E-G131G, E-G350, Em, Ep. 2013 Journal of lower genital tract disease Method HPV C109G;G131G 199;208 204;213 24456830 Replication interference between human papillomavirus types 16 and 18 mediated by heterologous E1 helicases. The codon 379 of the E1 gene in pF16E1 was changed from TAC to GCA by using PCR to produce pF16E1-Y379A, which expresses HPV16 E1 with amino acid substitution of tyrosine to alanine at aa residue 379. 2014 Virology journal Method HPV Y379A;Y379A 98;162 103;199 E1;E1 21;127 23;129 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Based on an equal distribution of prototype (E350T) and variant (E350G) sequences overall we ascertained that 50 samples from each of the cases and controls would be sufficient to observe a 50% difference in the distribution of the prototype and variant sequences between the cases and controls (p < 0.05). 2014 Infection, genetics and evolution Method HPV E350T;E350G 45;65 50;70 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. To create a full-length HPV16 (114/B) genome with a C161S substitution, the two complimentary oligonucleotides forward 5' GTGTTTAATTGGTTCTAAACCACCTATAGGGGAACAC 3' and reverse 5' GTGTTCCCCTATAGGTGGTTTAGAACCAATTAAACAC 3', changed GC to CT at nucleotides 6119-6120. 2014 PloS one Method HPV C161S 52 57 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. To create a full-length HPV16 (114/B) genome with a C229S substitution, the two complimentary oligonucleotides forward 5' GATATTTGTACATCTATTTCTAAATATCCAG 3' and reverse 5' CTGGATATTTAGAAATAGATGTACAAATATC 3', changed GC to CT at nucleotides 6323-6324. 2014 PloS one Method HPV C229S 52 57 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. To create a full-length HPV16 (114/B) genome with a C379S substitution, the two complimentary oligonucleotides forward 5' CAGTTTATTTTTCAACTGTCTAAAATAACCTTAACTGCAG 3' and reverse 5' CTGCAGTTAAGGTTATTTTAGACAGTTGAAAAATAAACTG 3', changed GC to CT at nucleotides 6772-6773. 2014 PloS one Method HPV C379S 52 57 25096873 Maturation of the human papillomavirus 16 capsid. A mutant version of the plasmid, p16mL1L2, carries a Cys175 Ser mutation in L1. 2014 mBio Method HPV C175S 53 63 L1 76 78 25096873 Maturation of the human papillomavirus 16 capsid. Cys175 Ser mutant capsids were allowed to mature for 1 h. 2014 mBio Method HPV C175S 0 10 25096873 Maturation of the human papillomavirus 16 capsid. Cys175 Ser mutant capsids were analyzed as described above. 2014 mBio Method HPV C175S 0 10 25096873 Maturation of the human papillomavirus 16 capsid. Particles were extracted and preprocessed using the graphical program X3D. 2014 mBio Method HPV X3D 70 73 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Amino acid substitution mutants of 16E2 and 16E2-E2HD including S207A, S243A, S207/243A, S243Q, S243E, S243N and S243D and R37A/I73A were generated from the EGFP-16E2 and EGFP-16E2-HDWT plasmids using PCR-directed mutagenesis. 2014 PloS one Method HPV S207A;S243A;S243Q;S243E;S243N;S243D;R37A;I73A 64;71;89;96;103;113;123;128 69;76;94;101;108;118;127;132 25483514 Anti-tumor effects of genetic vaccines against HPV major oncogenes. The E6F47R mutant (kindly provided by G Trave; Strasburg, France) that is defective for polyubiquitination and subsequent degradation of p53 was fused to Potato Virus X coat protein gene (CP), in order to obtain a novel recombinant genetic vaccine (De Giuli Morghen, Personal Communication). 2015 Human vaccines & immunotherapeutics Method HPV F47R 6 10 E6 4 6 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Briefly, after excision from the pX5-E6-F47R/6C6S plasmid using the EcoRI and NotI enzymes, the E6-F47R/6C6S gene was inserted into the pcDNA3 plasmid (Life Technologies Corp., Carlsbad, CA, USA). 2015 Journal of translational medicine Method HPV F47R;F47R 40;99 44;103 E6;E6 37;96 39;98 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Briefly, the genetically mutated E6F47R gene of HPV-16 was amplified by PCR from the pcDNA3E6F47R plasmid and inserted downstream of the VVH6 vaccinia virus early/late promoter into the pFPMCS vector, which contained the 3-beta-hydroxysteroid dehydrogenase 5-delta 4 isomerase gene and was interrupted by a multiple cloning site. 2015 Journal of translational medicine Method HPV F47R 35 39 E6 33 35 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Expression of the E6F47R gene in CEFs and Vero and MRC-5 cells was investigated first using RT-PCR. 2015 Journal of translational medicine Method HPV F47R 20 24 E6 18 20 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. One clone was selected for its correct and high expression of the E6F47R gene, as determined by RT-PCR, Western blotting and immunofluorescence using anti-E6-specific antibodies. 2015 Journal of translational medicine Method HPV F47R 68 72 E6;E6 66;155 68;157 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The DNA sequence that encodes the E6F47R region was amplified using the forward V364 (5' CCG CGC CCG GGA AGC TTA TGC ACC AAA AGA GAA CT 3') and the reverse V99 (5' CGA AGC TTT TAC AGC TGG GTT TCT CTA CG 3') primers. 2015 Journal of translational medicine Method HPV F47R 36 40 E6 34 36 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The expression of the E6F47R gene was also verified after transfection with the pcDNA3E6F47R plasmid by the PolyJet transfection reagent (SignaGen Lab., Rockville, MD, USA). 2015 Journal of translational medicine Method HPV F47R 24 28 E6 22 24 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The pDNAE6F47R expression plasmid was used for the mice immunizations, and it contains the mutated E6F47R sequence of the HPV-16 E6 gene. 2015 Journal of translational medicine Method HPV F47R 101 105 E6;E6 99;129 101;131 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The plasmid DNA was purified and the E6F47R was sequenced (Bio-Fab Research, Rome, Italy) to exclude any possible mutations arising from the PCR amplification and designated as pFPE6F47R (8,700 bp). 2015 Journal of translational medicine Method HPV F47R 39 43 E6 37 39 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The pX5-E6-F47R/6C6S plasmid that contains the mutated E6F47R gene was a kind gift from G. 2015 Journal of translational medicine Method HPV F47R;F47R 11;57 15;61 E6;E6 8;55 10;57 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The recombinant clones were identified by autoradiography after hybridization with the [32P]-labeled E6F47R probe, picked, and subjected to multiple cycles of plaque purification. 2015 Journal of translational medicine Method HPV F47R 103 107 E6 101 103 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The recombinant FP virus expressing the E6F47R protein (FPE6F47R) was obtained by in-vitro homologous recombination. 2015 Journal of translational medicine Method HPV F47R 42 46 E6 40 42 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. To detect the expression of the E6F47R protein, immunofluorescence was also carried out on CEFs and Vero and MRC-5 cells infected with 5 PFU/cell, as described previously. 2015 Journal of translational medicine Method HPV F47R 34 38 E6 32 34 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. To determine whether the E6F47R protein was expressed correctly, CEFs and Vero and MRC-5 cells were infected with 10 PFU/cell FPE6F47R and examined by Western blotting, as described previously. 2015 Journal of translational medicine Method HPV F47R 27 31 E6 25 27 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. For photoreactivation after UV treatment, double transgene positive animals were exposed to the light of 4 white fluorescent tubes (GE Lightning Polylux XL F36W/840) filtered through 5 mm of glass. 2015 Molecular cancer Method HPV F36W 156 160 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Site-directed mutagenesis of HPV8-E6 in K14CreERtam-HPV8-E6 (also called K14-HPV8-E6) and pcDNA3.1-Flag-HPV8-E6 was performed using the QuickChange Site-directed mutagenesis kit (Stratagene) with the primers HPV8-E6K136N-fw: 5' CGTCCCTTTCATAACGTTAGAGGAGGCTG 3' and HPV8-E6K136N-bw: 5' CAGCCTCCTCTAACGTTATGAAAGGGACG 3', leading to an AAA AAC exchange giving rise to HPV8-E6K136N. 2015 Molecular cancer Method HPV K136N;K136N;K136N 215;272;374 220;277;379 E6;E6;E6;E6;E6;E6;E6 34;57;82;109;213;270;372 36;59;84;111;215;272;374 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. To generate the K14-HPV8-E6K136N line, the linearized transgene, in which the HPV8-E6K136N gene is under the control of the human keratin-14 (K14) promoter, was microinjected into the pro-nucleus of fertilized FVB/n oocytes, which were implanted into pseudopregnant surrogate mothers to produce putative founder mice. 2015 Molecular cancer Method HPV K136N;K136N 27;85 32;90 E6;E6 25;83 27;85 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. Distribution of the polymorphic site T350G within HPV16_A1 variants was assessed by Pearson's chi-square test when stratified by geographical origin and by Fisher's test when stratified by anatomical location. 2016 Cancer medicine Method HPV T350G 37 42 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. For the displacements of complexes between pWT PDZ2 L391F or PDZO9 with the PGKETQL peptide the time-resolved high resolution traces of change in fluorescence displayed a possible biphasic behavior, but the two kobs values were not well separated (differed by a factor of 2.5). 2016 Scientific reports Method HPV L391F 52 57 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. In addition, constructs carrying either of the two mutations in PDZO9 (L391F and K392M, respectively) were created with site directed mutagenesis, and denoted pWT PDZ2 L391F and pWT PDZ2 K392M, respectively. 2016 Scientific reports Method HPV L391F;K392M;L391F;K392M 71;81;168;187 76;86;173;192 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Pseudo wild type SAP97 PDZ2 (pWT PDZ2) is a variant used in several previous studies and constituting SAP97 residues 311-407 and the mutations I342W and C372A. 2016 Scientific reports Method HPV I342W;C372A 143;153 148;158 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. The PGKETQL peptide was titrated into a solution of pWT PDZ2 L391F. 2016 Scientific reports Method HPV L391F 61 66 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. The HPV16 114/K genome, cloned into pUC19, was a kind gift from Ethel-Michele de Villiers (DKFZ, Germany) and was used as a template to introduce T3147-to-G and A3148-to-C mutations to encode E2Y131A by use of a QuikChange II XL kit (Agilent Technologies), the primer 5'-GATGGAGACATATGCAATACAATGCATGCTACAAACTGGACACATATATAT-3', and its reverse complement. 2017 Journal of virology Method HPV T3147Delta;T3147T;T3147O;A3148Delta;A3148T;A3148O;T3147G;A3148C 146;146;146;161;161;161;146;161 156;156;156;171;171;171;156;171 E2 192 194 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. A similar 4 x E2BS plasmid containing the A7874C variation in each of the four E2 BS2 was also synthesized. 2018 Scientific reports Method HPV A7874C 42 48 E2 79 81 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. All LCRs contained the A81C transversion found in other HPV33 isolates; a C at position 81 is considered the introduction of specific nucleotide changes into the prototype correct nucleotide although it is mistakenly replaced by an A in the GenBank reference sequence. 2018 Scientific reports Method HPV A81C 23 27 LCR 4 8 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. at a density of 25 000 cells and co-transfected 24 h later with the prototype or A7874C 4 x E2BS reporter plasmid (160 ng), pRL control vector (0.5 ng), and increasing amounts of 3F-E2 expression plasmid (0, 2.5, 5, 10, 20, 40 ng). 2018 Scientific reports Method HPV A7874C 81 87 E2 182 184 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Competition experiments were performed similarly, using the A7874C 4 x E2BS Fluc reporter plasmid (160 ng) and increasing amounts (0, 80, 160 and 320 ng) of competitor 4 x E2BS plasmid (PT or A7874C in pUC57). 2018 Scientific reports Method HPV A7874C;A7874C 60;192 66;198 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Fluc-reporter plasmids driven from the prototype and A7874C variant 4 x E2BS sequences were constructed by excising the 4 x E2BS sequences from pUC57 with KpnI and HindIII and subcloning them into pGL2-Basic (Promega) upstream of Fluc. 2018 Scientific reports Method HPV A7874C 53 59 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Apart from E7 T20I/G63S (V1; worldwide the second most prevalent variant which contributed to 22% of cases), we also included E7 G41R/G63D (V2) and E7 T74A/D76E (V3), which were respectively the most prevalent variant (51%) and the third most common variant (14%) worldwide in our study.27 We also generated artificial single mutants, V1A (T20I) and V1B (G63S) in order to delineate their individual functional roles. 2019 Journal of cellular and molecular medicine Method HPV V1A;T20I;G63S;G63D;G41R;T74A;D76E;T20I;G63S 335;14;19;134;129;151;156;340;355 338;18;23;138;133;155;160;344;359 E7;E7;E7 11;126;148 13;128;150 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. All LCRs contained the A81C transversion found in other HPV33 isolates; a C at position 81 is the correct nucleotide although it is mistakenly replaced by an A in the GenBank reference sequence. 2019 Scientific reports Method HPV A81C 23 27 LCR 4 8 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. After purification, the BCA protein assay kit was used to determine the concentration of HPVL1-C175A and HPVL1-C428A mutants. 2020 Nature communications Method HPV C175A;C428A 95;111 100;116 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. All the C175A/C428A mutations in the L1 genes were generated using the Fast Mutagenesis Kit. 2020 Nature communications Method HPV C175A;C428A 8;14 13;19 L1 37 39 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. For chPsVs, the mutant pAAV-HPV16L1-C175A and pAAV-HPV52L1-C428A plasmids were mixed in equal proportions for transfection into 293FT cells. 2020 Nature communications Method HPV C175A;C428A 36;59 41;64 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. For di-type chVLP, HPVL1-C175A and HPVL1-C428A mutants were mixed in an equimolar ratio and assembled in a buffer containing 10 mM PB6.5 and 0.5 M NaCl. 2020 Nature communications Method HPV C175A;C428A 25;41 30;46 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. For dose-dependent response immunogenicity evaluations, BALB/c mice (n = 4 per dose) were immunized intraperitoneally three times at an interval of 2 weeks (week 0, 2, and 4) with 5, 1, 0.2, 0.04, 0.008, or 0.002 mug dosages of HPV16L1-C175A-HPV52L1-C428A chVLPs or WT VLPs along with aluminum hydroxide adjuvant. 2020 Nature communications Method HPV C175A;C428A 236;250 241;255 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. For multi-type chVLPs, we followed the same equimolar principle for the content of L1-C175A and -C428A mutants. 2020 Nature communications Method HPV C175A;C428A 86;97 91;102 L1 83 85 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Purified HPV16 VLPs, HPV52 VLPs, and HPV16L1-C175A-HPV52L1-C428A chVLPs (~2.0 mg/mL) were vitrified on Quantifoil holey carbon grids in an FEI Vitrobot. 2020 Nature communications Method HPV C428A;C175A 59;45 64;50 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. The total or free sulfhydryl (SH) content of HPV16L1-C175A-HPV52L1-C428A chVLPs and WT VLPs was determined according to the method of Yongsawatdigul and Park. 2020 Nature communications Method HPV C428A;C175A 67;53 72;58 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. To initially assess the immunogenicity of HPV16L1-C175A-HPV52L1-C428A chVLPs, BALB/c mice (n = 4) were immunized intraperitoneally three times at an interval of 2 weeks (weeks 0, 2, and 4) with chVLPs or WT VLPs diluted in aluminum adjuvant (5.0 mug per dose). 2020 Nature communications Method HPV C175A;C428A 50;64 55;69 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. To build the N29S and H51N variants, the 3D structure obtained from the PDB was edited with the PyMOL program (). 2021 International journal of molecular sciences Method HPV H51N;N29S 22;13 26;17 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. To the N29S variant, we added 4578 water molecules, 35 Na+, and 13 Cl-, and to the H51N variant, 4731 water molecules, 33 Na+, and 13 Cl- were added. 2021 International journal of molecular sciences Method HPV H51N;N29S 83;7 87;11 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Amino acids (aa) 1 to 200 of E2-WT and E2-S23A were produced as a fused protein with His tag, and TopBP1 was produced as a fused protein with a glutathione S-transferase (GST) tag (GST TopBP1 [aa 32 to 1522] His from Addgene; plasmid 20375). 2021 mBio Method HPV S23A 42 46 E2;E2 29;39 31;41 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. C2527; NEB Inc.) and growing it in LB medium supplemented with 100 mug/ml of selective antibiotics (kanamycin for His-tagged E2-WT and E2-S23D; ampicillin for GST-tagged TopBP1), grown overnight at 37 C, and shaken at a low speed. 2021 mBio Method HPV S23D 138 142 E2;E2 125;135 127;137 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. GST-TopBP1 and GST control were kept stable at 0.65 pmol, and 11 pmol of His-E2-WT and His-E2-S23D was used for the experiment. 2021 mBio Method HPV S23D 94 98 E2;E2 77;91 79;93 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. HPV16 mutant genomes (S23A and S23D) were generated by Genscript. 2021 mBio Method HPV S23A;S23D 22;31 26;35 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Purified recombinant His-tagged E2-WT and E2-S23D protein and GST-tagged TopBP1 were used for the in vitro pulldown assays. 2021 mBio Method HPV S23D 45 49 E2;E2 32;42 34;44 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Stable cell lines expressing wild-type E2 (E2-WT), E2-S23A, and E2-S23D, along with pcDNA empty vector plasmid control were established both in U2OS and N/Tert-1 cell lines as previously described. 2021 mBio Method HPV S23A;S23D 54;67 58;71 E2;E2;E2;E2 39;43;51;64 41;45;53;66 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The HPV16 (WT, S23A, S23D) were removed from their parental plasmid using SphI, and the viral genomes were isolated and then recircularized using T4 ligase (NEB) and transfected into early passage HFK from three donor backgrounds (Lifeline Technology), alongside a G418 resistance plasmid, pcDNA. 2021 mBio Method HPV S23A;S23D 15;21 19;25 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. U2OS cells expressing stable E2-WT, E2-S23A, and pcDNA empty vector plasmid control were plated at 3 x 105 density onto 100-mm plates in DMEM plus 10% FBS. 2021 mBio Method HPV S23A 39 43 E2;E2 29;36 31;38 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. U2OS cells expressing stable E2-WT, E2-S23A, and pcDNA empty vector plasmid control were plated on acid-washed, poly-l-lysine-coated coverslips, in a six-well plate at a density of 2 x 105 cells/well (5 ml Dulbecco modified Eagle medium [DMEM] plus 10% fetal bovine serum [FBS] [DMEM-FBS]). 2021 mBio Method HPV S23A 39 43 E2;E2 29;36 31;38 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day after the last injection, plasmids Pkt2-Luc-T2a-E7(N53S)-T2a-E6(R55K)(delK75), pT/Caggs-NRasV12, and pCMV(CAT)T7-SB100 were injected into the submucosa of the oral/pharyngeal cavity (10 mug/plasmid, 30 muL/injection), followed by EP with an Electro Square Porator (Holliston, MA), as described previously. 2022 mBio Method HPV N53S;R55K 59;72 63;76 E6;E7 69;56 71;58 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Similarly, 293-AAD cells were transfected with either pcDNA3-CRT/16E7 or pcDNA3-CRT/16E7(N53S) using Lipofectamine 2000. 2022 mBio Method HPV N53S 89 93 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. The amplified PCR product was then cloned into the EcoRI/BstXI sites of Pkt2-Luc-T2a-E7(N53S)-T2a-E6. 2022 mBio Method HPV N53S 88 92 E6;E7 98;85 100;87 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. The DNA vaccines pcDNA3-CRT/16E6, pcDNA3-CRT/16E6(R55K), and pcDNA3-CRT/16E6(R55K)(delK75) were prepared by using an endotoxin-free kit (Qiagen, Valencia, CA). 2022 mBio Method HPV R55K;R55K 50;77 54;81 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. The generation of pcDNA3-CRT/16E7 and pcDNA3-CRT/16E7(N53S) were described previously. 2022 mBio Method HPV N53S 54 58 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To assess CD8+ T cell epitope presentation by either wild-type HPV16 E7 or mutant HPV16 E7(N53S), first we transfected 293-Db cells with either pcDNA3-CRT/16E7 or pcDNA3-CRT/16E7(N53S) using Lipofectamine 2000. 2022 mBio Method HPV N53S;N53S 91;179 95;183 E7;E7 69;88 71;90 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To establish HPV16 E6/E7-expressing oral/pharyngeal tumor model using AKT and c-Myc oncogenes, all the procedures were the same as described above, except the following plasmids were used: Pkt2-Luc-T2a-E7(N53S)-T2a-E6 (R55K)(delK75), pKT2/CLP-AKT, Pkt2-cMyc, and pCMV(CAT)T7-SB100 (10 mug/plasmid, 30 muL/injection). 2022 mBio Method HPV N53S;R55K 205;219 209;223 E6;E6;E7;E7 19;215;22;202 21;217;24;204 Oral/pharyngeal tumor 36 57 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To establish the HPV16 E6 peptide (aa 72 to 80)-specific CD8+ T cell line, splenocytes from female C57BL/6 mice vaccinated with pcDNA3-CRT/HPV16 E6(R55K) DNA, followed by boost vaccination with TA-HPV by skin scarification at a dose of 5 x 104 PFU/mouse 1 week later, were harvested 1 week after the last vaccination. 2022 mBio Method HPV R55K 148 152 E6;E6 23;145 25;147 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To generate pcDNA3-CRT/16E6(R55K), HPV16 E6(R55K) DNA was first amplified via PCR using the pcDNA3-CRT/16E6 template and the following set of primers: 5'-GGCCGAATTCATGCACCAAAAGAGAACTG-3', 5'-GTTACTGCGACGTGAGGTATTTGAATTTGCTTTTAAGGATTTATGCATAGTATATA-3', 5'-TATATACTATGCATAAATCCTTAAAAGCAAATTCAAATACCTCACGTCGCAGTAAC-3', and 5'-GCCAAGCTTTTACAGCTGGGTTTCTCTAC-3'. 2022 mBio Method HPV R55K;R55K 28;44 32;48 E6 41 43 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To generate pcDNA3-CRT/16E6(R55K)(delK75), 16E6(R55K)(delK75) DNA was first amplified via PCR using the pcDNA3-CRT/16E6 (R55K) template and the following set of primers: 5'-GGCCGAATTCATGCACCAAAAGAGAACTG-3', 5'-GCTGTATGTGATAAATGTTTATTTTATTCTAAAATTAGTGAG-3', 5'-CTCACTAATTTTAGAATAAAATAAACATTTATCACATACAGC-3', and 5'-GCCAAGCTTTTACAGCTGGGTTTCTCTAC-3'. 2022 mBio Method HPV R55K;R55K;R55K 28;48;121 32;52;125 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To generate Pkt2-Luc-T2a-E7(N53S)-T2a-E6 (R55K)(delK75), E6 (R55K)(delK75) DNA was first amplified via PCR using the pcDNA3-CRT/16E6(R55K)(delK75) template and the following set of primers: 5'-TTTGAATTCGAGGGCAGAGGAAGTCTTCT-3', and 5'-TTTCCAGCTAGCTGGTTACAGCTGGGTTTCTCTACG -3'. 2022 mBio Method HPV N53S;R55K;R55K;R55K 28;42;61;133 32;46;65;137 E6;E6;E7 38;57;25 40;59;27 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. To generate Pkt2-Luc-T2a-E7(N53S)-T2a-E6, E7(N53S) DNA was first amplified via PCR using the Pkt2-Luc-T2a-E7-T2a-E6 template and the following set of primers: 5'-AAACTCGAGGAGGGCAGAGGAAGTCTTCT-3', 5'-AGAACCGGACAGAGCCCATTACAGTATTGTAACCTTTTGTTGCAAGTG-3', 5'-CACTTGCAACAAAAGGTTACAATACTGTAATGGGCTCTGTCCGGTTCT-3', and 5'-TTTGAATTCTGGTTTCTGAGAACAGATGG-3'. 2022 mBio Method HPV N53S;N53S 28;45 32;49 E6;E6;E7;E7;E7 38;113;25;42;106 40;115;27;44;108 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. The E6 structure on this PDB contains 151 residues with four-point mutations in S80C, S97C, S111C, and S140, which were reverted to obtain the E6 reference in the PyMOL Molecular Graphics System, Version 2.0 Schrodinger, LLC. 2022 Scientific reports Method HPV S80C;S97C;S111C 80;86;92 84;90;97 E6;E6 4;143 6;145 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. The mutations were done as indicated next, to obtained E-G350: L83V; E-C188/G350: E29Q and L83V; E-A176/G350: D25N and L83V; AAa: Q14H, H78Y, and L83V; for AAc: Q14H, I27R, H78Y, and L83V. 2022 Scientific reports Method HPV E29Q;L83V;L83V;D25N;L83V;Q14H;H78Y;L83V;Q14H;I27R;H78Y;L83V 82;63;91;110;119;130;136;146;161;167;173;183 86;67;95;114;123;134;140;150;165;171;177;187 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. A statistically significant trend for an increased prevalence of E6-L83V with increasing severity of the lesion (P=0.04) was observed, while this was not the case for LCR-7193/7521 (P=0.15) (Table 2). 2002 British journal of cancer Result HPV L83V 68 72 LCR;E6 167;65 170;67 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. E6-L83V, on the other hand, has previously been shown to be associated with high-grade lesions and cancer in Swedish women and Norwegian women (Zehbe et al, 1998b; Andrew Jenkins, personal communication). 2002 British journal of cancer Result HPV L83V 3 7 E6 0 2 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. In the Finnish group, E6-L83V was associated with progression in 50% of the cases, whereas the same genotype was present in only 20% of the regressing lesions. 2002 British journal of cancer Result HPV L83V 25 29 E6 22 24 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. In the LCR the nt changes at positions 7193 and 7521 (51%) were most frequently detected and in the E6 gene, L83V was most frequently detected (67%). 2002 British journal of cancer Result HPV L83V 109 113 LCR;E6 7;100 10;102 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. Interestingly, the change in promoter activity could be singled out to just one nt exchange being an A to G change at position 78. 2002 British journal of cancer Result HPV A78G 101 129 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. LCR-7193/7521 and E6-L83V were found together in 15 cases (33%) and prototype sequences in both regions were present in seven cases (16%). 2002 British journal of cancer Result HPV L83V 21 25 LCR;E6 0;18 3;20 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. Since the association of L83V with disease status is similar in Swedish and Finnish women, the data of the two groups were pooled in the current study. 2002 British journal of cancer Result HPV L83V 25 29 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. US56 exhibited altogether four sequence variations but only one singular to this clone, namely the G>A transition at nt position 78. 2002 British journal of cancer Result HPV G78A 99 131 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. We next determined, whether the most frequently detected genotypes, LCR-7193/7521 and E6-L83V, correlate with disease status. 2002 British journal of cancer Result HPV L83V 89 93 LCR;E6 68;86 71;88 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. In order to map the domains of E7 required for its induction of tetrasomy, we investigated seven HPV16 E7 mutants: H2P, Delta6-10, Delta21-24, C24G, S31G/S32G, A50S and S71I. 2004 British journal of cancer Result HPV H2P;C24G;S31G;S32G;A50S;S71I 115;143;149;154;160;169 118;147;153;158;164;173 E7;E7 31;103 33;105 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. In raft culture the same pattern emerged with the exception that the S31G/S32G protein gave a similar level of tetrasomy to wild type and C24G (Figure 2C). 2004 British journal of cancer Result HPV S31G;S32G;C24G 69;74;138 73;78;142 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. In the first group, represented by wild-type HPV-16 E7 and the mutant proteins A50S and S71I, a thick epithelium is formed containing uniformly undifferentiated cells throughout. 2004 British journal of cancer Result HPV A50S;S71I 79;88 83;92 E7 52 54 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Induction of tetrasomy occurs in rafts from each class, namely HPV-16 E7 wild type, C24G and S31G/S32G. 2004 British journal of cancer Result HPV C24G;S31G;S32G 84;93;98 88;97;102 E7 70 72 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Mutations H2P and Delta6-10 are located in conserved region 1 (CR1), mutations Delta21-24, C24G and S31G/S32G are located in CR2 and mutations A50S and S71I are located close to the C-terminal metal-binding domain (Figure 2A). 2004 British journal of cancer Result HPV H2P;C24G;S31G;S32G;A50S;S71I 10;91;100;105;143;152 13;95;104;109;147;156 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Only the C24G mutant E7 protein was able to induce levels of tetrasomy similar to wild-type HPV16 E7 in monolayer culture (Figure 2B). 2004 British journal of cancer Result HPV C24G 9 13 E7;E7 21;98 23;100 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The other mutants all showed strongly reduced levels of tetrasomy with least loss of effect being shown by the C-terminal mutants A50S and S71I. 2004 British journal of cancer Result HPV A50S;S71I 130;139 134;143 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The second group, represented by the mutant proteins H2P, Delta6-10, Delta21-24 and C24G, as well as the LXSN vector, forms a very thin epithelium containing differentiated cells. 2004 British journal of cancer Result HPV H2P;C24G 53;84 56;88 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The third group, represented only by mutant protein S31G/S32G, shows a thick epithelium with distinct layers of basal (undifferentiated) and spinous (differentiated) cells. 2004 British journal of cancer Result HPV S31G;S32G 52;57 56;61 17192187 Human papillomavirus typing of invasive cervical cancers in Italy. Interestingly, the A257G mutation has been firstly described very recently, and occurred in combination with the T350G variant, as in our case. 2006 Infectious agents and cancer Result HPV A257G;T350G 19;113 24;118 17192187 Human papillomavirus typing of invasive cervical cancers in Italy. Of the naturally occurring HPV 16 viral variants, the T350G (L83V) is the most commonly found among invasive cancers, and has been linked to an increased risk for cervical disease progression. 2006 Infectious agents and cancer Result HPV T350G;L83V 54;61 59;65 Cervical diseases 163 179 17192187 Human papillomavirus typing of invasive cervical cancers in Italy. Sequence analysis of the E6 gene in 25 HPV 16 positive ICC cases showed the presence of the T350G mutation in the great majority (18/25, 72%), in 4 cases also accompanied by other mutations; among the mutations identified, A257G, C335T, T350G, A442C lead to amino acid changes (I52V, H78Y, L83V, E113D, respectively), while C256T, T286A, A289G are silent not leading to amino acid changes. 2006 Infectious agents and cancer Result HPV E113D;T350G;A257G;C335T;T350G;A442C;I52V;H78Y;L83V;C256T;T286A;A289G 296;92;223;230;237;244;278;284;290;324;331;338 301;97;228;235;242;249;282;288;294;329;336;343 E6 25 27 Cervical carcinoma 55 58 17192187 Human papillomavirus typing of invasive cervical cancers in Italy. The E6 pattern corresponded to the prototype in 7 cases, while the T350G mutation was present in 18; as single mutation in 14, with another mutation in 3 (T256C, A257G, A442C, respectively), and with three additional mutations in 1 (T286A, A289G, C335T). 2006 Infectious agents and cancer Result HPV T350G;T256C;A257G;A442C;T286A;A289G;C335T 67;155;162;169;233;240;247 72;160;167;174;238;245;252 E6 4 6 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Both WT and K292R mutant E2 proteins were predominantly nuclear and partly cytoplasmic, and there was no apparent difference in the distribution of these two types of 16E2 protein. 2008 Virology Result HPV K292R 12 17 E2 25 27 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). but only the K292R mutant of 16E2 lost the ability to be sumoylated while the K172R and K351R mutants did not. 2008 Virology Result HPV K292R;K172R;K351R 13;78;88 18;83;93 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Consequently, to investigate the effect of sumoylation on E2 transcriptional repression activity, we compared the wildtype E2 protein with the sumoylation-defective K292R mutant E2 protein in the HeLa colony formation assay. 2008 Virology Result HPV K292R 165 170 E2;E2;E2 58;123;178 60;125;180 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Due to the location of K292 in the DBD of HPV16 E2, it was possible that the K292R mutation affected DNA binding by the mutant protein, and that a defect in this function accounted for the reduced transcriptional activity. 2008 Virology Result HPV K292R 77 82 E2 48 50 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). From these results we conclude that the K292R mutation is unlikely to negatively affect the dimerization or the DNA binding ability of 16E2. 2008 Virology Result HPV K292R 40 45 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Furthermore, compared to the large and numerous neomycin-resistant colonies formed in the absence 16E2, wild-type and the K292R mutant 16E2 not only reduced the number of colonies formed, but also decreased the size of these colonies. 2008 Virology Result HPV K292R 122 127 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Furthermore, since the K292R mutation does not appear to influence the DNA binding activity or subcellular localization of 16E2, the most likely explanation for the reduced transcriptional activity of the K292R mutant is that sumoylation has a modest regulatory role in E2 transcriptional activity. 2008 Virology Result HPV K292R;K292R 23;205 28;210 E2 270 272 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Hence, it was important to determine if the subcellular localization of 16E2 was influenced by the K292R mutation which could result in differences in transcriptional activities. 2008 Virology Result HPV K292R 99 104 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). The amount of purified GST-16E2WT and GST-16E2K292R used in EMSA was first measured by Western blot of serially diluted samples. 2008 Virology Result HPV K292R 46 51 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). The K292R mutation does not affect E2 DNA binding or localization. 2008 Virology Result HPV K292R 4 9 E2 35 37 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). The pattern of the EGFP-16E2WT (Fig. 7C, upper panel) mirrored that of the lysine 292 to arginine mutant (Fig. 7C, lower panel). 2008 Virology Result HPV K292R 75 97 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). To confirm that the K292R mutation did not impede the binding of 16E2 to the E2-specific sequence (E2BS), we performed an EMSA using GST, GST-16E2WT, and GST-16E2K292R. 2008 Virology Result HPV K292R 20 25 E2 77 79 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). To investigate the contribution of sumoylation to E2 transactivation activity, we examined the activity of wild-type and K292R HPV16 E2 in C33A cells using an E2-activated reporter vector (p6xE2BS-Luc) with 6 E2 binding sites. 2008 Virology Result HPV K292R 121 126 E2;E2;E2;E2 50;133;159;209 52;135;161;211 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Most importantly, significant differences in late apoptotic cell numbers were seen between E6 prototype and L83V versus R10G/L83V and Q14D/H78Y/L83V. 2009 Virology Result HPV L83V;R10G;L83V;H78Y;L83V;Q14D 108;120;125;139;144;134 112;124;129;143;148;138 E6 91 93 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Overall area intensity of K10 staining in the suprabasal layer was lower in the prototype, L83V and R10G/L83V rafts as compared to the empty vector raft, with the difference being statistically significant (Figure 4B). 2009 Virology Result HPV L83V;R10G;L83V 91;100;105 95;104;109 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Similar but not significant results were obtained with R10G/L83V. 2009 Virology Result HPV R10G;L83V 55;60 59;64 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. The prototype and L83V NIKS on the other hand showed lower levels of late apoptotic cells than control NIKS but this finding was not statistically significant. 2009 Virology Result HPV L83V 18 22 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. The Q14H/H78Y/L83V raft showed a staining intensity comparable to that of the vector. 2009 Virology Result HPV L83V;Q14H;H78Y 14;4;9 18;8;13 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. The R10G/L83V culture exhibited the highest staining and compared to vector, prototype and Q14H/H78Y/L83V rafts the difference was statistically significant. 2009 Virology Result HPV R10G;L83V;Q14H;H78Y;L83V 4;9;91;96;101 8;13;95;100;105 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. With regard to late apoptotic cells, only Q14D/H78Y/L83V showed statistically significant results compared to vector control cells. 2009 Virology Result HPV H78Y;L83V;Q14D 47;52;42 51;56;46 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A tree was thus constructed with the six E6-HPV16 ORF sequences representing each of the variants identified, including those containing the single nucleotide changes A334G and A404T. 2009 Infectious agents and cancer Result HPV A334G;A404T 167;177 172;182 E6 41 43 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Although the HSIL + ICC fraction was even higher for the AA-a, E-T350G and E-C188G variants, the number of samples of these variants were too small to reach definitive conclusions on their oncogenicity (Table 4). 2009 Infectious agents and cancer Result HPV T350G;C188G 65;77 70;82 Squamous intraepithelial lesions;Cervical carcinoma 13;20 17;23 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Association of cervical lesions with E-P A334G sequences. 2009 Infectious agents and cancer Result HPV A334G 41 46 Cervical lesions 15 31 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Comparing all sequences it was not possible to resolve the A404T non synonymous mutation as a group independent of the E-P Ref sequence. 2009 Infectious agents and cancer Result HPV A404T 59 64 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. E-T350G variants had the expected substitution of leucine for valine at position 83 (L83V). 2009 Infectious agents and cancer Result HPV T350G;L83V;V83L 2;85;50 7;89;83 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. For the E subtype the most frequent was the E-P Ref variant with 27 cases (71.1%) followed by the E-T350G variant (seven cases, 18.4%) and the E-C188G variant (two cases, 5.3%). 2009 Infectious agents and cancer Result HPV T350G;C188G 100;145 105;150 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. In this way the AA-a variant and the three known E-P variants (E-P Ref, E-T350G and E-C188G) could be related, with two new branches of the E subtype corresponding to those carrying the A334G and A404T changes. 2009 Infectious agents and cancer Result HPV T350G;C188G;A334G;A404T 74;86;186;196 79;91;191;201 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The A334G synonymous substitution was found in 22 sequences, located next to nucleotide 335, commonly used for subtype-variant identification. 2009 Infectious agents and cancer Result HPV A334G 4 9 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The A404T change identified in a single sample, produced the I101F change. 2009 Infectious agents and cancer Result HPV A404T;I101F 4;61 9;66 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The A404T change was observed in a single E-P variant. 2009 Infectious agents and cancer Result HPV A404T 4 9 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The C173A substitution produced the H24N change in one sequence, and the A182T the I27L changes in another one. 2009 Infectious agents and cancer Result HPV C173A;H24N;A182T;I27L 4;36;73;83 9;40;78;87 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The C206T change present in an E-T350G variant generated a stop codon instead of amino acid 35 and T351A caused the L83E change in the same sample. 2009 Infectious agents and cancer Result HPV C206T;T350G;T351A;L83E;ins 35X 4;33;99;116;59 9;38;104;120;94 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The C37A change identified in an E-P variant produced the change Q91K. 2009 Infectious agents and cancer Result HPV C37A;Q91K 4;65 8;69 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The expected amino acid changes were also found in AA-a (Q14H; H78Y; L83V) and E-C188G variants (E20Q; L83V). 2009 Infectious agents and cancer Result HPV E20Q;Q14H;H78Y;L83V;C188G;L83V 97;57;63;69;81;103 101;61;67;73;86;107 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The presence of the A334G change in 19 of the 32 E-P sequences (70.4%) makes the corresponding HPV16 "variant" the most prevalent in San Luis Potosi City. 2009 Infectious agents and cancer Result HPV A334G 20 25 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The proportion of HSIL and ICC lesions ("HSIL + ICC fraction") associated to the 19 A334G variants (0.21) was clearly higher than that associated to the eight E-P Ref variants (0.00). 2009 Infectious agents and cancer Result HPV A334G 84 89 Squamous intraepithelial lesions;Squamous intraepithelial lesions;Cervical carcinoma;Cervical carcinoma 18;41;27;48 22;45;30;51 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. Among the other tested E2 mutants, C85A UbcH5A showed detectable increase in the level of Rb. 2010 Virology Result HPV C85A 35 39 E2 23 25 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. As shown in Figure 5C, C92A E2-25K increased the half-life of E7 in absence of a functional Rb. 2010 Virology Result HPV C92A 23 27 E2;E7 28;62 30;64 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. C92A E2-25K also extended the half-life of E7 in the transfected cells, suggesting that E7 and Rb proteolysis are linked in this assay. 2010 Virology Result HPV C92A 0 4 E2;E7;E7 5;43;88 7;45;90 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. C92A E2-25K blocks E7-induced proteolysis of Rb. 2010 Virology Result HPV C92A 0 4 E2;E7 5;19 7;21 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. Co-transfection of C92A E2-25K increased the half-life of Rb to 6h in presence of E7 by almost completely blocking the proteolysis. 2010 Virology Result HPV C92A 19 23 E2;E7 24;82 26;84 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. In a parallel assay, the mutant C85A UbcH5A could not effectively change the half-life of Rb. 2010 Virology Result HPV C85A 32 36 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. Interestingly, a significant increase in the E7 protein was observed in the C92A E2-25K transfected cells, and a detectable increase of E7 was observed in the mutant C85A UbcH5A transfected cells. 2010 Virology Result HPV C92A;C85A 76;166 80;170 E2;E7;E7 81;45;136 83;47;138 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. Interestingly, co-transfection of the C92A E2-25K mutant almost completely restored the Rb level in presence of E7 (Fig.4C, lane 4). 2010 Virology Result HPV C92A 38 42 E2;E7 43;112 45;114 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. To test whether C92A E2-25K can stabilize E7 in absence of Rb, the half-life of E7 was analyzed both in presence and absence of mutant E2-25K in C33A cells that carry mutant cellular Rb protein. 2010 Virology Result HPV C92A 16 20 E2;E2;E7;E7 21;135;42;80 23;137;44;82 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. V5-epitope tagged Rb and HPV16 E7 were co-transfected in C33A cells together with C87A E2-20K, C92A E2-25K, C93A UbcH3, C85A UbcH5A, C85A UbcH5B, and C85A UbcH5C. 2010 Virology Result HPV C87A;C92A;C93A;C85A;C85A;C85A 82;95;108;120;133;150 86;99;112;124;137;154 E2;E2;E7 87;100;31 89;102;33 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. while the C87A E2-20K, C93A UbcH3, C85A UbcH5B, and C85A UbcH5C showed no significant effect. 2010 Virology Result HPV C87A;C93A;C85A;C85A 10;23;35;52 14;27;39;56 E2 15 17 21159359 Expression of human papillomavirus type 16 E7 is sufficient to significantly increase expression of angiogenic factors but is not sufficient to induce endothelial cell migration. Although the HPV 16 E7C24G mutant has been reported to retain the ability to target another pRb family member, p107, for degradation, the ability of this mutant to target p130 for degradation has not been reported. 2011 Virology Result HPV C24G 22 26 E7 20 22 21159359 Expression of human papillomavirus type 16 E7 is sufficient to significantly increase expression of angiogenic factors but is not sufficient to induce endothelial cell migration. By changing the cysteine at amino acid 24 to a glycine (C24G), HPV 16 E7 loses affinity for pRb and the ability to target pRb for degradation. 2011 Virology Result HPV C24G;C24G 56;16 60;54 E7 70 72 21159359 Expression of human papillomavirus type 16 E7 is sufficient to significantly increase expression of angiogenic factors but is not sufficient to induce endothelial cell migration. In contrast, VEGF expression was increased 8.7-fold (p< 0.0001) in cells expressing HPV 16E6E7C24G compared to retrovirus control LXSN (p< 0.0001) (Figure 4B) and to a greater extent than conditioned media from HPV 16E6E7-expressing cells (Figure 4B). 2011 Virology Result HPV C24G 94 98 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. All cultures were dysplastic with abnormal stratification, showing more or less than the expected epithelial thickness, nuclear atypia and lack of cell polarity (most pronounced in the R48W raft). 2011 Molecular cancer Result HPV R48W 185 189 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. K14 another marker of basal cells, was mainly expressed in the basal layer of rafts, except for R8Q, which showed uniform staining in all layers (Figure 4C-D). 2011 Molecular cancer Result HPV R8Q 96 99 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. NIKS transduced with R48W exhibited the highest levels of late apoptotic cells, with the difference from the empty vector NIKS and NIKS expressing L83V being statistically significant (Figure 5B). 2011 Molecular cancer Result HPV R48W;L83V 21;147 25;151 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. R10G and L83V variants also showed lower activity than R8Q but the difference was not statistically significant. 2011 Molecular cancer Result HPV R10G;L83V;R8Q 0;9;55 4;13;58 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. R8Q exhibited K10 staining in the uppermost layer only. 2011 Molecular cancer Result HPV R8Q 0 3 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Staining was uniform in the L83V rafts, whereas only sporadic staining was observed in the R8Q, R10G and R48W rafts (Figure 4A-B). 2011 Molecular cancer Result HPV R8Q;R10G;L83V;R48W 91;96;28;105 94;100;32;109 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The area intensity of K14 in the suprabasal part of the R8Q rafts was significantly higher than that of LXSN and all other E6 rafts. 2011 Molecular cancer Result HPV R8Q 56 59 E6 123 125 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The area intensity of K5 in the suprabasal layers was the strongest in the R8Q raft culture with the difference in intensity from LXSN, L83V, R10G and R48W being statistically significant (Figure 4A-B). 2011 Molecular cancer Result HPV R8Q;R10G;L83V;R48W 75;142;136;151 78;146;140;155 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The differences in activity between R48W and both R8Q and L83V were statistically significant. 2011 Molecular cancer Result HPV R8Q;R48W;L83V 50;36;58 53;40;62 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The E6 L83V, which is highly represented in European populations and in cervical carcinomas, was included for comparison. 2011 Molecular cancer Result HPV L83V 7 11 E6 4 6 Cervical carcinoma 72 91 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The highest efficiency in overcoming the G1 block was exhibited by the E6 variants R10G (r = 0.9) and R48W (r = 0.8), while R8Q showed the lowest efficiency (r = 1.4) (Figure 2C). 2011 Molecular cancer Result HPV R10G;R8Q;R48W 83;124;102 87;127;106 E6 71 73 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The L83V NIKS showed approximately 20% lower levels of apoptotic cells than LXSN NIKS. 2011 Molecular cancer Result HPV L83V 4 8 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The R8Q variant raft showed a considerably lower number of epithelial layers than the raft cultures expressing the vector LXSN. 2011 Molecular cancer Result HPV R8Q 4 7 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The R8Q variant showed the highest hyperactivation activity and the R48W showed the lowest activity. 2011 Molecular cancer Result HPV R8Q;R48W 4;68 7;72 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The raft cultures derived from R8Q and R48W demonstrated mostly undifferentiated cells with little cytoplasm, while L83V and R10G demonstrated strata with undifferentiated and differentiated keratinocytes. 2011 Molecular cancer Result HPV R8Q;R10G;R48W;L83V 31;125;39;116 34;129;43;120 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. These results showed no statistically significant difference in the activities between the rare (R8Q, R10G, R48W) and common L83V variants, consistent with previously described data. 2011 Molecular cancer Result HPV R8Q;R10G;R48W;L83V 97;102;108;125 100;106;112;129 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. those with low prevalence in cervical carcinomas of previously studied European populations, including variant R8Q, R10G, and R48W. 2011 Molecular cancer Result HPV R8Q;R10G;R48W 111;116;126 114;120;130 Cervical carcinoma 29 48 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. A genomic approach using oligonucleotide microarrays showed that 14 genes involved in interspecies interactions between organisms (including the immune system) and stress response were modulated by the E6 D25E oncogene at an mRNA level. 2011 Virology journal Result HPV D25E 205 209 E6 202 204 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Additionally, HPV-16 E6 L83V is associated with an increased risk of persistent infection and cytological progression to CIN types 2 and 3 and to squamous cell carcinoma in European populations. 2011 Virology journal Result HPV L83V 24 28 E6 21 23 Squamous cell carcinoma;Cervical intraepithelial neoplasia 146;121 169;124 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. As shown in Figure 1, the E6 mRNA and protein were detected in wild-type E6- or D25E variant-expressing C33A cells. 2011 Virology journal Result HPV D25E 80 84 E6;E6 26;73 28;75 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. By analyzing a genome-wide microarray, we observed significant transcriptional changes in 211 genes of the wild-type E6 or D25E protein-expressing cell lines compared with the control cell line using a filter criterion of at least 1.5-fold change with p < 0.05. 2011 Virology journal Result HPV D25E 123 127 E6 117 119 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. evaluated functions relevant to carcinogenesis for the E6 variants L83V, R10/L83V and Q14H/H78Y/L83V as well as for the prototype. 2011 Virology journal Result HPV L83V;L83V;L83V;Q14H;H78Y 67;77;96;86;91 71;81;100;90;95 E6 55 57 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Furthermore, one HPV-16 E6 variant harboring an amino acid change at position 83 by substituting leucine for valine (L83V) was reported in Swedish and Italian populations, and another change at position 25 by substituting aspartic acid for glutamic acid (D25E) was reported in Japanese and Chinese populations: these were associated with the progression of cervical carcinoma. 2011 Virology journal Result HPV L83V;D25E 117;255 121;259 E6 24 26 Cervical carcinoma 357 375 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. However, no studies have addressed the molecular relationship between the E6 D25E variant and cervical carcinogenesis. 2011 Virology journal Result HPV D25E 77 81 E6 74 76 Cervical diseases 94 117 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. In agreement with epidemiological studies showing a link between the L83V variant and an increased risk of malignant disease, functional studies have demonstrated that the E6 L83V variant has biological advantages over E6 wild-type. 2011 Virology journal Result HPV L83V;L83V 69;175 73;179 E6;E6 172;219 174;221 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. In China, HPV 16 D25E variant was detected in 62% of the patients with cervical cancer. 2011 Virology journal Result HPV D25E 17 21 Cervical carcinoma 71 86 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. In the present study, AIFM2 was reduced in E6 D25E oncoprotein expressing cell lines. 2011 Virology journal Result HPV D25E 46 50 E6 43 45 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. In this study, based on microarray analysis, we showed that ROCK2 is up-regulated in E6 D25E expressing cell lines. 2011 Virology journal Result HPV D25E 88 92 E6 85 87 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. It means that E6 D25E might be involved to promote the survival of HPV-infected cells in a manner that facilitates tumor development. 2011 Virology journal Result HPV D25E 17 21 E6 14 16 HPV infections 67 79 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Nine genes (ZMZ1, RPL23, MAPK4, RPL31, RARS, LAMB3, HSPA14, AIFM2, IFRD1) were down-regulated and five genes (UBC, RPS9, HLA-A, -B, ROCK2) were up-regulated in E6 D25E expressing cells. 2011 Virology journal Result HPV D25E 163 167 E6 160 162 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Our data showed that the MAPK pathway-associated genes MAPK-2, -3 and -4 were down-regulated in contrast to L83V and the expression levels of immune response-related human histocompatibility leukocyte antigen (HLA) genes HLA-A and HLA-B were elevated in E6 D25E-expressing cells. 2011 Virology journal Result HPV L83V;D25E 108;257 112;261 E6 254 256 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Our findings suggest that E6 D25E might have a unique oncogenic role in cancerous transformation but further studies are needed to define the molecular mechanisms and carcinogenic potential of the HPV-16 D25E variant. 2011 Virology journal Result HPV D25E;D25E 29;204 33;208 E6 26 28 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Our previous study showed that HPV-16 E6 D25E is the most prevalent variant in Korean women at high risk for developing cervical cancers. 2011 Virology journal Result HPV D25E 41 45 E6 38 40 Cervical carcinoma 120 136 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. The incidences of the variants in ICC from Japanese women were as follows: D25E in 44% of women, L83V in 28%, and other variants in 16%. 2011 Virology journal Result HPV D25E;L83V 75;97 79;101 Cervical carcinoma 34 37 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. The wild-type E6 and D25E variant genes were amplified from HPV-16-infected cervical swabs and inserted into a pLenti6.3/V5-TOPO lentiviral vector (Invitrogen, Carlsbad, CA, USA) followed by sequence analysis. 2011 Virology journal Result HPV D25E 21 25 E6 14 16 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. There were 118 common transcripts revealed in both cell lines, 79 transcripts that were regulated by wild-type E6 and 14 transcripts that were unique in the E6 D25E-expressing cells. 2011 Virology journal Result HPV D25E 160 164 E6;E6 111;157 113;159 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. These findings are in the conflict with the epidemical data for oncogenic role of variant but it is still unclear whether HPV variant D25E have distinct oncogenical properties via HLA or MAPK regulation. 2011 Virology journal Result HPV D25E 134 138 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This effect is enhanced by the E6 L83V variant, which activates the MAPK signaling through Rap1, independent of Ras. 2011 Virology journal Result HPV L83V 34 38 E6 31 33 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This increased expression of ROCK2 is indicative of a possible involvement of E6 D25E protein in the malignant transformation of cervical cells. 2011 Virology journal Result HPV D25E 81 85 E6 78 80 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This is the first study to identify functional differences in the naturally occurring HPV-16 E6 D25E variant in C33A cell lines and provides a basis for future mechanistic studies. 2011 Virology journal Result HPV D25E 96 100 E6 93 95 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This result contributes new and useful information to support the epidemiological data showing that there is more frequent detection of the D25E variant in patients with cervical cancer, and that several genes such as AIFM2, RPL23, and ROCK2 might be involved in cervical tumorigenicity via E6 D25E. 2011 Virology journal Result HPV D25E;D25E 140;294 144;298 E6 291 293 Cervical carcinoma 170 185 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This result indicates that RPL23 might be directly or indirectly related to oncogenesis by E6 D25E. 2011 Virology journal Result HPV D25E 94 98 E6 91 93 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. This study aimed at identifying genes affected by the HPV-16 E6 D25E variant in comparison with the wild-type E6 in the C33A HPV-negative cervical cancer cell line using microarrays. 2011 Virology journal Result HPV D25E 64 68 E6;E6 61;110 63;112 Cervical carcinoma 138 153 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. To identify alterations in the gene regulatory network that might be associated with the presence of the HPV-16 E6 D25E compared with wild-type E6 in cervical carcinogenesis, we performed microarray analyses in HPV-negative cancer cell lines expressing recombinant wild-type E6 or E6 D25E variant proteins. 2011 Virology journal Result HPV D25E;D25E 115;284 119;288 E6;E6;E6;E6 112;144;275;281 114;146;277;283 Cervical diseases;HPV-associated cancer 150;211 173;230 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. To investigate the role of individual viral oncoproteins of HPV-16 wild-type E6 and the D25E variant on cervical cancer progression, we stably transduced the E6 expression vector into C33A cells. 2011 Virology journal Result HPV D25E 88 92 E6;E6 77;158 79;160 Cervical carcinoma 104 119 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. We have reported that E6 D25E is the most prevalent variant (68%) in Korean women at high risk for cervical cancers. 2011 Virology journal Result HPV D25E 25 29 E6 22 24 Cervical carcinoma 99 115 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. We observed that the HPV-16 E6 D25E-expressing C33A cells modulated several functional genes compared with wild-type E6-expressing cells. 2011 Virology journal Result HPV D25E 31 35 E6;E6 28;117 30;119 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. C33A cells were transiently transfected either with pX-HPV-16 E7 wild-type, pX-HPV-16 E7Delta79LEDLL83, pX-HPV-16 E7Delta52YNIVT56, pX-HPV-16 E7C24G or pX, as indicated. 2012 Virology Result HPV C24G 144 148 E7;E7 62;142 64;144 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. E7C24G bound Miz-1 with wild-type efficiency. 2012 Virology Result HPV C24G 2 6 E7 0 2 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. In contrast, E7C24G, which fails to bind and inactivate pRB, was able to bind and repress Miz-1-induced p21Cip1 gene expression with an efficiency similar to that of wild-type E7. 2012 Virology Result HPV C24G 15 19 E7;E7 13;176 15;178 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. The cd2-mutant E7C24G repressed the p21Cip1 gene expression to a similar extent as wild-type E7. 2012 Virology Result HPV C24G 17 21 E7;E7 15;93 17;95 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. These domains have been defined by inactivating mutations in cd2 (C24G) and cd3 (Delta79LEDLL83, Delta52YNIVT56. 2012 Virology Result HPV C24G 66 70 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. While co-transfection of Miz-1 and the cd2-mutant E7C24G repressed transactivation by Miz-1 with activity similar to that of wild-type E7, the repressing activity of the two carboxyl-terminal E7 mutants, Delta52YNIVT56 and Delta79LEDLL83, was significantly reduced. 2012 Virology Result HPV C24G 52 56 E7;E7;E7 50;135;192 52;137;194 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Among these 53 samples 17% (9/53) carried the R10G and 34% (18/53) the L83V mutation. 2012 PloS one Result HPV R10G;L83V 46;71 50;75 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. However, no significant correlation was found when DSF was compared between patients with presence or absence of the R10G variant or between patients with presence or absence of the L83V variant (data not shown). 2012 PloS one Result HPV R10G;L83V 117;182 121;186 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. However, when samples with the European type containing minor nucleotide differences (including R10G and L83V) were included, these figures increased to 93, 94 and 96% respectively. 2012 PloS one Result HPV R10G;L83V 96;105 100;109 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. HPV16 E6 variants at amino acid R10G and L83V. 2012 PloS one Result HPV R10G;L83V 32;41 36;45 E6 6 8 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The E-T350G variant was the most common one among all the three groups of samples. 2012 PloS one Result HPV T350G 6 11 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The majority (12/21) of the E6 from TSCC harboring R10G also contained L83V. 2012 PloS one Result HPV R10G;L83V 51;71 55;75 E6 28 30 Tonsillar squamous cell carcinoma 36 40 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The most common were Q14H and H78Y, both present in 4% of CC and CS, while 7% of TSCC had Q14H and H78Y. 2012 PloS one Result HPV Q14H;H78Y;Q14H;H78Y 21;30;90;99 25;34;94;103 Cervical carcinoma;Tonsillar squamous cell carcinoma 58;81 60;85 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The most remarkable difference between TSCC and CC was found with regard to the frequencies of the E-A131G variant causing a change from arginine to glycine in a.a. 2012 PloS one Result HPV A131G 101 106 Tonsillar squamous cell carcinoma;Cervical carcinoma 39;48 43;50 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The presence of the R10G or L83V variants in tonsillar cancer was analyzed in correlation to the 3-year disease-free survival (DSF) of the patients. 2012 PloS one Result HPV R10G;L83V 20;28 24;32 Tonsillar cancer 45 61 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The TSCC samples were compared with regard to patient and tumor characteristics based on the presence of R10G, L83V or absence of these variants as presented in Table 1. 2012 PloS one Result HPV R10G;L83V 105;111 109;115 Tonsillar squamous cell carcinoma 4 8 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. There were however no significant differences for any of these parameters, although there was a tendency for tumors with R10G to have a lower T stage. 2012 PloS one Result HPV R10G 121 125 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. This variant, causing a shift from leucine to valine in aa 83 (L83V), was especially common in TSCC (45%) followed by CC (31%) and CS (29%) respectively. 2012 PloS one Result HPV L83V;L83V 63;35 67;61 Tonsillar squamous cell carcinoma;Cervical carcinoma 95;118 99;120 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. To further validate the increased frequencies of R10G and L83V mutations in TSCC, 53 additional TSCC samples, from patients diagnosed at the same hospital during the same period, were evaluated only for the R10G and L83V mutations. 2012 PloS one Result HPV R10G;R10G;L83V;L83V 49;207;58;216 53;211;62;220 Tonsillar squamous cell carcinoma;Tonsillar squamous cell carcinoma 76;96 80;100 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Validation of R10G and L83V frequencies in further TSCC samples. 2012 PloS one Result HPV R10G;L83V 14;23 18;27 Tonsillar squamous cell carcinoma 51 55 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. When all the 108 samples were summarized 19% had R10G and 40% the L83V mutation. 2012 PloS one Result HPV R10G;L83V 49;66 53;70 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. However, there were two missense variations in the E5 oncogene I44L and I65V. 2012 PloS one Result HPV I44L;I65V 63;72 67;76 E5 51 53 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. In the E6 region there was only one missense variation, the G350 (L83V) variation, while E7 region was completely free of variation. 2012 PloS one Result HPV L83V 66 70 E6;E7 7;89 9;91 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The sequencing of the whole genome and additional full length E1 sequences revealed that all analyzed samples of the E1-1374 63nt E-G350 variant had the E1 1053 A>C change and the E1-1374 63nt duplication resulting with the insertion of 21 extra amino acids in the E1 protein. 2012 PloS one Result HPV A1053C 156 164 E1;E1;E1;E1;E1 62;117;153;180;265 64;119;155;182;267 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. There was only one additional change within the E1 region (2184 G>A) that was not seen in the full genome sequences. 2012 PloS one Result HPV G2184A 59 67 E1 48 50 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. All isolates with G41R also carried G63D, and a significant interaction was found (p = 0.023). 2013 International journal of cancer Result HPV G41R;G63D 18;36 22;40 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. It was found that T20I and/or G63S conferred an independent increase in risk for CIN3 and invasive cervical cancer (adjusted odds ratio 4.44, 95% CI. 2013 International journal of cancer Result HPV T20I;G63S 18;30 22;34 Cervical intraepithelial neoplasia;Cervical carcinoma 81;90 85;114 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Similarly, all isolates with T20I also carried G63S, and a significant interaction was found (p = 0.002). 2013 International journal of cancer Result HPV T20I;G63S 29;47 33;51 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. The risk association observed for G41R and/or G63D was no longer significant after multivariate analysis. 2013 International journal of cancer Result HPV G41R;G63D 34;46 38;50 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Two E7 substitutions (G41R and G63D) showed a significantly lower risk, and the other two E7 substitutions (T20I and G63S) showed a significantly higher risk based on univariate analysis (Table 2). 2013 International journal of cancer Result HPV G41R;G63D;T20I;G63S 22;31;108;117 26;35;112;121 E7;E7 4;90 6;92 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. We therefore selected G41R and T20I into two separate final regression models, respectively, controlling for age and country of origin. 2013 International journal of cancer Result HPV G41R;T20I 22;31 26;35 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. All the others were synonymous mutations, including A5571G, T5972C, G6111A, G6218A, T6701G, T6764G, A6794G, C6824T, C6917A and G7802A. 2012 International journal of molecular sciences Result HPV A5571G;T5972C;G6111A;G6218A;T6701G;T6764G;A6794G;C6824T;C6917A;G7802A 52;60;68;76;84;92;100;108;116;127 58;66;74;82;90;98;106;114;122;133 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Among them, three (23.1%) novel mutations of C5640T, A5641T and G5642A, which led to the Q26L amino acid change, were identified in nine strains (Table 1). 2012 International journal of molecular sciences Result HPV C5640T;A5641T;G5642A;Q26L 45;53;64;89 51;59;70;93 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Analysis of the complete E7 open reading frame showed two synonymous substitutions of C751T and A801G. 2012 International journal of molecular sciences Result HPV C751T;A801G 86;96 91;101 E7 25 27 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Besides the CTT 7681-7683 deletion, another three mutations of G7622A, T7624G/C and G7861A were present in all obtained sequences, too. 2012 International journal of molecular sciences Result HPV G7622A;T7624G;T7624C;G7861A 63;71;71;84 69;79;79;90 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Compared to the reference sequence, all the obtained sequences harbored the nucleotide variation of G350A and 65 had the nonsynonymous mutation of A379G (K93R) in the E6 gene (Table 2). 2012 International journal of molecular sciences Result HPV G350A;A379G;K93R 100;147;154 105;152;158 E6 167 169 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Except for C6917A, all the other mutations in HPV 52 L1 gene were not reported previously. 2012 International journal of molecular sciences Result HPV C6917A 11 17 L1 53 55 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Furthermore, two nonsynonymous mutations of A5641T and G5642A were covariations. 2012 International journal of molecular sciences Result HPV A5641T;G5642A 44;55 50;61 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. In particular, the nucleotide substitutions of G7622A and T7624G/C were located in the TATA binding site, as well as C/EBP and SRY binding sites. 2012 International journal of molecular sciences Result HPV T7624C;G7622A;T7624G 58;47;58 66;53;66 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. One covariation pattern and a statistically significant association were found among A7657C, T7659C, G7712C and A7865G mutations. 2012 International journal of molecular sciences Result HPV A7657C;T7659C;G7712C;A7865G 85;93;101;112 91;99;107;118 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The A379G (K93R) mutation was located in the strand H1 and the third predicted zinc finger of E6 protein. 2012 International journal of molecular sciences Result HPV A379G;K93R 4;11 9;15 E6 94 96 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The CTT7681-7683 deletion was located in the NF-E2 and AP-1 binding sites; the nucleotide substitution of G7861A was located in the Oct-1 binding site. 2012 International journal of molecular sciences Result HPV G7861A 106 112 E2 48 50 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The other frequent polymorphic sites included A7657C, T7659C, G7712C and A7865G, that were detected in more than 64 strains. 2012 International journal of molecular sciences Result HPV A7657C;T7659C;G7712C;A7865G 46;54;62;73 52;60;68;79 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The Q26L amino acid mutation was located in the strand beta-B1 of L1 protein. 2012 International journal of molecular sciences Result HPV Q26L 4 8 L1 66 68 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The variations of A7657C, T7659C, G7712C and A7865G, which were predicted at the binding sites for AP-1, HSF, MAT alp, Skn-1 and HFS, introduced additional putative binding sites for cellular proteins, such as Cap, Cdxa, Skn-1, and Oct-1 or HSF. 2012 International journal of molecular sciences Result HPV A7657C;T7659C;G7712C;A7865G 18;26;34;45 24;32;40;51 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. 1O) and a C to A transversion at nt5147 (n = 10, 17.9%). 2013 PloS one Result HPV C5147A 10 39 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. a C to G transversion at nt3084 and a G to C transversion at nt3085, leading to a R90A AA change (n = 11, 19.6%). 2013 PloS one Result HPV C3084G;G3085C;R90A 2;38;82 31;67;86 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. a C to G transversion at nt5701 with an AA change of P91R (n = 23, 41.1%). 2013 PloS one Result HPV C5701G;P91R 2;53 31;57 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. a C to G transversion at nt6460 with an AA change of P344R (n = 24, 42.9%). 2013 PloS one Result HPV C6460G;P344R 2;53 31;58 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. a C to G transversion at nt6625 with an AA change of P399R (n = 25, 44.6%). 2013 PloS one Result HPV C6625G;P399R 2;53 31;58 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. a C to G transversion at nt6842 with an AA change of P471R (n = 23, 41.1%). 2013 PloS one Result HPV C6842G;P471R 2;53 31;58 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. Among these variations, T2856C, G2857C, C2858G and G2859T were simultaneous, as were C3084G and G3085C. 2013 PloS one Result HPV T2856C;G2857C;C2858G;G2859T;C3084G;G3085C 24;32;40;51;85;96 30;38;46;57;91;102 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. and a C to G transversion at nt3275, which does not lead to an AA change (n = 7, 12.5%). 2013 PloS one Result HPV C3275G 6 35 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. and an A to G transition at nt864, leading to a N92S AA substitution (n = 1, 1.79%). 2013 PloS one Result HPV A864G;N92S 7;48 33;52 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. and G to A transition at nt6906 with an AA change of D493N (n = 12, 21.4%). 2013 PloS one Result HPV G6906A;D493N 4;53 31;58 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. DNA sequence analysis of HPV-18 L2 region revealed two variations that did not lead to AA changes: a C to T transition at nt4915 (n = 11, 19.6%). 2013 PloS one Result HPV C4915T 101 128 L2 32 34 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. DNA sequence analysis of the HPV-18 E1 region revealed the following four variations: a T to G transversion at nt2856 and a G to C transversion at nt2857 leading to a L648C AA substitution (n = 18, 32.1%), and a C to G transversion at nt2858 and a G to T transversion at nt2859 leading to a R649V AA change (n = 18, 32.1%). 2013 PloS one Result HPV T2856G;G2857C;L648C;C2858G;G2859T;R649V 88;124;167;212;248;291 117;153;172;241;277;296 E1 36 38 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. DNA sequence analysis of the HPV-18 E2 region revealed seven variations: a T to G transversion at nt2856, G to C transversion at nt2857 and C to G transversion at nt2858, leading to a C14A AA substitution (n = 18, 32.1%); a G to T transversion at nt2859, leading to a V15L AA substitution (n = 18, 32.1%). 2013 PloS one Result HPV T2856G;G2857C;C2858G;C14A;G2859T;V15L 75;106;140;184;224;268 104;135;169;188;253;272 E2 36 38 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. DNA sequence analysis of the HPV-18 E7 region revealed two variations, both of which occurred only once and in the same specimen: a C to T transition at nt640, which did not result in an AA change. 2013 PloS one Result HPV C640T 132 158 E7 36 38 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. DNA sequence analysis of the HPV-18 L1 region revealed six variations: a G to A transition at nt5503, leading to a R25Q AA substitution (n = 23, 41.1%). 2013 PloS one Result HPV G5503A;R25Q 73;115 100;119 L1 36 38 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. The most frequent variation was a C to G transversion at nt287 (n = 27, 48.2%). 2013 PloS one Result HPV C287G 34 62 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. with a less frequent A to C transversion occurring at nt551 (n = 9, 16.1%) (Fig.1 F). 2013 PloS one Result HPV A551C 21 59 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. However, in women over 45 years, two variants prevail: E350G/442C and Af2 which are present in 35.53% (27/76) and 25% (19/76) respectively, statistical analyses were significant for only HPV16 E and Af variants related to patients' age (p < 0.0001). 2013 BMC infectious diseases Result HPV E350G 55 60 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Moreover, among women under 45 years, E350G/442C is the most predominant variant with 48.15% of cases (13/27). 2013 BMC infectious diseases Result HPV E350G 38 43 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. The most prevalent non-synonymous variants were L83V (T350G), H78Y (C335T), E113D (A442C) and Q14D (C143G/G145T) and were observed respectively in 65%, 41.8%, 38.8% and 30.1% of total samples. 2013 BMC infectious diseases Result HPV E113D;L83V;T350G;H78Y;C335T;A442C;Q14D;C143G;G145T 76;48;54;62;68;83;94;100;106 81;52;59;66;73;88;98;105;111 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. The other non-synonymous variants were R10I (G132T), R10G (A131G), D64E (T295G), Q14H (G145T) and A61G (C285G) and were seen in 23.3%, 6.8%, 6.8%, 1.9% and 1% of cases respectively. 2013 BMC infectious diseases Result HPV R10I;R10G;G132T;A131G;D64E;T295G;Q14H;G145T;A61G;C285G 39;53;45;59;67;73;81;87;98;104 43;57;50;64;71;78;85;92;102;109 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A co-variation of 10 sites, including C7294T, G7319A, A7326G, T7350A, T7368G, T7503G, A7515C, G7553T, A7602G and A7740T in LCR was observed in 22 isolates (7.2%, 22/304). 2013 BMC cancer Result HPV C7294T;G7319A;A7326G;T7350A;T7368G;T7503G;A7515C;G7553T;A7602G;A7740T 38;46;54;62;70;78;86;94;102;113 44;52;60;68;76;84;92;100;108;119 LCR 123 126 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Among the EUR lineage, the variants E350G and E131G were seen in 9.9% (30/304) and 3.0% (9/304) of the 304 women, respectively. 2013 BMC cancer Result HPV E350G;E131G 36;46 41;51 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Among the populations infected by the HPV16 E variant of T350G, 16 women (9.5%, 16/168, 95% CI 14.8-29.9) were persistent infections and 12 women (11.3%, 12/106, 95% CI 15.5-36.5) were transient infections. 2013 BMC cancer Result HPV T350G 57 62 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Controlling for study site, age and smoking, detection of the variant R10G/L83V (OR 4.7, 95% CI 1.0-23.5; p=0.04) was significantly associated with risk for developing >=CIN2,3. 2013 BMC cancer Result HPV R10G;L83V 70;75 74;79 Cervical intraepithelial neoplasia 170 174 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In the co-variation of 10 sites, the variation of A7515C resulted in loss of a binding site for the human activator AP-1, while the variation of A7602G resulted in an addition of binding site for the cellular transcription factor Oct-1. 2013 BMC cancer Result HPV A7515C;A7602G 50;145 56;151 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Nucleotide variations of E6 included 4 silent mutations of G94A, G176A, C215T and T241G and 5 missense mutations of A131C, T178G/A, C335T, T350G and A442C, which led to amino acid variations of R10G, D25E, H78Y, L83V and E113D, respectively. 2013 BMC cancer Result HPV T178A;R10G;E113D;G94A;G176A;C215T;T241G;A131C;T178G;C335T;T350G;A442C;D25E;H78Y;L83V 123;194;221;59;65;72;82;116;123;132;139;149;200;206;212 130;198;226;63;70;77;87;121;130;137;144;154;204;210;216 E6 25 27 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Several variations in E6 and LCR were co-segregated, including T178G in E6 gene and T7201C, C7270T, A7287C, A7289C, A7730C, G7842A in LCR, which were observed in 106 isolates (34.9%, 106/304). 2013 BMC cancer Result HPV T178G;T7201C;C7270T;A7287C;A7289C;A7730C;G7842A 63;84;92;100;108;116;124 68;90;98;106;114;122;130 LCR;LCR;E6;E6 29;134;22;72 32;137;24;74 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The C7294T co-variation in LCR, which include 10 variations, occurred in 4 strains from the 137 women with =CIN2,3, and was significantly associated with development of >=CIN2,3 (OR 3.8, 95% CI 0.8-19.6; p=0.03) (Table 4). 2013 BMC cancer Result HPV C7294T 4 10 LCR 27 30 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 108;156;219 112;160;223 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The most common LCR variations were G7193T, 7434CIns, G7521A, 7863ADel, which were found in 100% of HPV16 isolates. 2013 BMC cancer Result HPV G7193T;G7521A 36;54 42;60 LCR 16 19 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The most frequent nucleotide variation was T178G/A (49.7%, 151 of 304), in which T178G was found in 113 strains and T178A in 38 strains (Table 2). 2013 BMC cancer Result HPV T178G;T178A;T178G;T178A 43;43;81;116 50;50;86;121 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The rank orders of E6 variants in amino acid were as follows: D25E (49.7%, 151/304), L83V (9.9%, 30/304), H78Y (4.3%, 13/304), R10G (3.0%, 9/304) and E113D (2.6%, 8/304). 2013 BMC cancer Result HPV R10G;E113D;D25E;L83V;H78Y 127;150;62;85;106 131;155;66;89;110 E6 19 21 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The variation of G7193T resulted in loss of a putative binding site for the cellular transcription factor SRY. 2013 BMC cancer Result HPV G7193T 17 23 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The variations of R10G/L83V occurred in 1 isolate from the 137 women with < CIN2,3 and 8 isolates from the 167 women with >=CIN2,3. 2013 BMC cancer Result HPV R10G;L83V 18;23 22;27 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 76;124 80;128 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Two nonsynonymous variations of A131G (R10G) and T350G (L83V) were observed in HPV16 E6 gene. 2013 BMC cancer Result HPV R10G;A131G;T350G;L83V 39;32;49;56 43;37;54;60 E6 85 87 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Further, nucleotide variation analyses showed a novel aa variation at position 381 from glutamine (prototype) to glutamic acid (Q381E) in sample 6. 2013 PloS one Result HPV Q381E 128 133 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. In contrast, Q381E exhibited a reduced activity for supporting HPV16 replication, and Y379F completely lost the replication activity as expected. 2013 PloS one Result HPV Q381E;Y379F 13;86 18;91 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Intriguingly, the nucleotide substitutions observed in the E1 gene of sample 6 cause amino-acid (aa) changes in the E1 protein: methionine at aa position 326 to isoleucine, and glutamine at aa position 381 to glutamic acid. 2013 PloS one Result HPV M326I;Q381E 128;177 171;222 E1;E1 59;116 61;118 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. The de novo assembled HPV16 genomes from clinical specimens revealed aa polymorphisms of the E1 protein in its DNA-binding domain at aa positions 294 and 326: a replacement of leucine (prototype) at position 294 with methionine (L294M) in 2 LSIL specimens (#3 and #4) and that of isoleucine (prototype) at position 326 with methionine (I326M) in all the specimens (Figure 5A). 2013 PloS one Result HPV L294M;I326M;L294M;I326M 230;337;229;336 235;342;234;341 E1 93 95 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. The E1 mutant Y379F (in which tyrosine at 379 is replaced with phenylalanine), which is expected to lose replication activity as reported previously, was also included as a representative of a replication-deficient E1 protein. 2013 PloS one Result HPV Y379F;Y379F 14;30 19;76 E1;E1 4;215 6;217 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. The nucleotide substitution in the E6 gene detected in sample 6 also leads to an aa change in the E6 protein, glutamic acid to aspartic acid at aa position 25. 2013 PloS one Result HPV E25D 110 158 E6;E6 35;98 37;100 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Under these assay conditions, two E1 variants, L294M and I326M, showed replication activities almost comparable to the parental E1 (Figure 5C). 2013 PloS one Result HPV L294M;I326M 47;57 52;62 E1;E1 34;128 36;130 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Western blot analyses revealed that the expression levels of I326M, Q381E, and Y379F were comparable to that of the prototype E1 (Figure 5D), indicating that the reduced replication activity of Q381E is not due to reduced protein level. 2013 PloS one Result HPV I326M;Q381E;Y379F;Q381E 61;68;79;194 66;73;84;199 E1 126 128 24456830 Replication interference between human papillomavirus types 16 and 18 mediated by heterologous E1 helicases. Furthermore, an amino-acid substitution mutant F16E1-Y379A, which is supposed to negate the ability of E1 to oligomerize on single-stranded DNA and to bind to the replication origin, did not inhibit HPV18 replication. 2014 Virology journal Result HPV Y379A 53 58 E1 103 105 24456830 Replication interference between human papillomavirus types 16 and 18 mediated by heterologous E1 helicases. Importantly, the OD mutant, F16E1-Y379A, showed reduced binding efficiency compared to F16E1. 2014 Virology journal Result HPV Y379A 34 39 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. 2) which highlighted seven sites of significant variation: five in the LCR (G7193T, A7316C, T7449C, T7495C and G7520) and two in the E6 gene (T109C and T350G). 2014 Infection, genetics and evolution Result HPV G7193T;A7316C;T7449C;T7495C;T109C;T350G 76;84;92;100;142;152 82;90;98;106;147;157 LCR;E6 71;133 74;135 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. For example, T7449C was overrepresented in South Asian sequences (65% of sequences; 95%CI 45-81%) compared to the average (18%; 95%CI 14-23%; n = 255) (p < 0.001) and the T350G was underrepresented in East Asian sequences (8%; 95%CI 2-38%) compared to the average (44%; 95%CI 38-51%) (p = 0.014). 2014 Infection, genetics and evolution Result HPV T7449C;T350G 13;171 19;176 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. G7193T (found in 65% of sequences) is positioned within a TEF1 binding site and G7520A is within a YY1 binding site. 2014 Infection, genetics and evolution Result HPV G7193T;G7520A 0;80 6;86 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. G7193T was found in 61% (95%CI 42-77%) of control sequences and 66% (55-77%) of cases giving a crude OR of 1.28 (0.50-3.20; p = 0.665). 2014 Infection, genetics and evolution Result HPV G7193T 0 6 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. In addition, variants bearing both G7193T and G7520A substitutions did not alter the ability of p97 to drive luciferase reporter expression in one study. 2014 Infection, genetics and evolution Result HPV G7193T;G7520A 35;46 41;52 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. In the present study, the T350G substitution was found in 45% (28-64%) of control sequences and 39% (28-51%) of cases giving a crude OR of 0.77 (0.31-1.91; p = 0.534). 2014 Infection, genetics and evolution Result HPV T350G 26 31 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. In this latter study, the T350G variant was over-represented in cases compared to controls, while in another analysis the T350G variant was under-represented in cases from Europe/Central Asia while being over-represented in cases from South/Central America. 2014 Infection, genetics and evolution Result HPV T350G;T350G 26;122 31;127 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Of the five LCR variant positions, G7193T and G7520A were present in around 65% and 69% of sequences, respectively, while A7316C, T7449C and T7495C were present in around 10-15% of sequences, mostly in combination with other LCR or E6 variant sites. 2014 Infection, genetics and evolution Result HPV G7193T;G7520A;A7316C;T7449C;T7495C 35;46;122;130;141 41;52;128;136;147 LCR;LCR;E6 12;225;232 15;228;234 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Overall, the T350G (L83V) substitution was present in 41% (95%CI 32-51%) of sequences in this study which was lower than the 54% (51-57%) reported across Europe in a recent meta-analysis (p = 0.009). 2014 Infection, genetics and evolution Result HPV T350G;L83V 13;20 18;24 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Similarly, G7520A was found in 64% (45-80%) of control sequences and 71% (60-81%) of cases giving a crude OR of 1.43 (0.54-3.66; p = 0.501). 2014 Infection, genetics and evolution Result HPV G7520A 11 17 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. The T109C substitution in E6 (found in 5% of sequences) is a silent change that does not affect the Phe residue at codon 2. 2014 Infection, genetics and evolution Result HPV T109C 4 9 E6 26 28 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Variation within YY1 binding sites, including G7520A, can affect individual site-specific binding of YY1 but multiple YY1 binding site disruptions, akin to those found in the major AA and Afr variant lineages, are required to affect E6 promoter (p97) activity significantly. 2014 Infection, genetics and evolution Result HPV G7520A 46 52 E6 233 235 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. While the use of single infection samples should have reduced potential confounding factors in relation to the assignment of disease status, the data overall suggest that no individual or combination of LCR-E6 site variants, including T350G, displayed any apparent association with cervical disease. 2014 Infection, genetics and evolution Result HPV T350G 235 240 LCR;E6 203;207 206;209 Cervical diseases 282 298 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. 10- and 20-day C161S, C229S, and C379S viral titers were 50% or less than 10- and 20-day wild-type titers. 2014 PloS one Result HPV C161S;C229S;C379S 15;22;33 20;27;38 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. As C229S is already non-infectious at 10 days, it suggests that C229 provides an essential step in assembly prior to the virion reaching a pre-mature state that is ultimately necessary for viral infectivity. 2014 PloS one Result HPV C229S 3 8 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. At both 10 and 20 days C161S and C379S mutant virus were less than 25% as infectious compared to wild-type virus. 2014 PloS one Result HPV C161S;C379S 23;33 28;38 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C161S, C229S, and C379S had relative stabilities of 3.0, 7.4, and 4.4, respectively. 2014 PloS one Result HPV C161S;C229S;C379S 0;7;18 5;12;23 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. Establishment of Productive HPV16 C161S, C229S, and C379S Cell Lines. 2014 PloS one Result HPV C161S;C229S;C379S 34;41;52 39;46;57 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. However, 20-day C161S and C379S mutant virus were no more infectious than 10-day mutant virus. 2014 PloS one Result HPV C161S;C379S 16;26 21;31 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. It has been previously shown that C161S, C229S, and C379S mutations in HPV16 VLPs result in capsid instability, as mutant VLPs were more susceptible to tryptic proteolysis than wild-type. 2014 PloS one Result HPV C161S;C229S;C379S 34;41;52 39;46;57 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. The 3 mutants had much lower infectivity than wild-type, with the C379S mutant being the most infectious (S1). 2014 PloS one Result HPV C379S 66 71 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. The C161S, C229S, and C379S mutants have different genome fractionation profiles, with less genomes detected in the stable fractions 6-9, at 24.3%, 10.3%, and 18.2% respectively. 2014 PloS one Result HPV C161S;C229S;C379S 4;11;22 9;16;27 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. The C229S mutant was non-infectious. 2014 PloS one Result HPV C229S 4 9 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. Titers did not change significantly between 10- and 20-day wild-type, C161S, C229S, and C379S viral preparations. 2014 PloS one Result HPV C161S;C229S;C379S 70;77;88 75;82;93 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. To test whether C161S, C229S, and C379S substitutions affected steps in capsid assembly and maturation, we quantified the viral titers from 10- and 20-day tissues assessing the ability of wild-type and mutant L1 proteins to assemble and protect viral genomes from an endonuclease. 2014 PloS one Result HPV C161S;C229S;C379S 16;23;34 21;28;39 L1 209 211 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. Using C161S, C229S, and C379S mutant virus, we investigated their capsid assembly and stability by subjecting virions to Optiprep gradient ultracentrifugation, which has previously been reported to make viral genomes susceptible to endonuclease digestion if a capsid is unstable. 2014 PloS one Result HPV C161S;C229S;C379S 6;13;24 11;18;29 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. We had previously described some cysteine mutants designed to prevent inter-pentameric disulfide bonding (C175S and C185S) that increased in infectivity from 10 to 20 days of tissue growth. 2014 PloS one Result HPV C175S;C185S 106;116 111;121 25096873 Maturation of the human papillomavirus 16 capsid. Although Cys175 is critically involved in the formation of inter-L1 disulfide cross-links, the C175S mutation does not abrogate infectivity in vitro. 2014 mBio Result HPV C175S 95 100 L1 65 67 25096873 Maturation of the human papillomavirus 16 capsid. Finally, we analyzed capsids produced using HPV16 L1 carrying a Cys175 Ser mutation, which prevents the formation of Cys175-Cys428 disulfide bonds, which are essential for maturation. 2014 mBio Result HPV C175S 64 74 L1 50 52 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. 2A shows that only the S243A mutant protein was defective in binding to Brd4 (lane 5), and not the wild type E2 and S207A (lanes 3 and 4) or wild type E2 with IgG precipitates (lane 1). 2014 PloS one Result HPV S243A;S207A 23;116 28;121 E2;E2 109;151 111;153 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. 4A and 4B show that both the wild type and S207A E2 proteins were associated with mitotic chromosomes and colocalized with Brd4 in metaphase and anaphase. 2014 PloS one Result HPV S207A 43 48 E2 49 51 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Because Brd4 binding can increase the stability of the E2 protein and it also has been reported that the E2 protein is unstable when not bound to the chromosomes, we carried out a pulse-chase experiment and compared the half-life of the S207A and S243A mutants to the wild type E2 protein. 2014 PloS one Result HPV S207A;S243A 237;247 242;252 E2;E2;E2 55;105;278 57;107;280 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. C33A cells were used to express the wild type or S243A mutant E2 proteins and, as shown in. 2014 PloS one Result HPV S243A 49 54 E2 62 64 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. During metaphase and anaphase, wild type E2 and S207A could bind with the mitotic chromosomes, but S243A was excluded from the condensed chromosomes and anaphase chromosomes and was located in the cytosol that was similar to well-known mutant 16E2 R37A/I73A. 2014 PloS one Result HPV S207A;S243A;I73A;R37A 48;99;253;248 53;104;257;252 E2 41 43 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. E2 proteins capable of phosphorylation at serine 243, including the phosphor-mimetic substitutions S243D and S243E, were able to interact with Brd4 (lanes 6 and 8), while E2 proteins with S243A, S243Q and S243N lost the ability to bind to Brd4. 2014 PloS one Result HPV S243D;S243E;S243A;S243Q;S243N 99;109;188;195;205 104;114;193;200;210 E2;E2 0;171 2;173 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. HEK293 cells were transfected with the expression vectors for EGFP-tagged HPV-16 E2, S207A or S243A mutant proteins and the cell lysates were immunoprecipitated with anti-Brd4 antibody in an incubation buffer containing EtBr to avoid DNA interference. 2014 PloS one Result HPV S207A;S243A 85;94 90;99 E2 81 83 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. HEK293 cells were transfected with the expression vectors for wild type, S207A or S243A-mutated E2 proteins for 36 h and then treated with cycloheximide to block de novo protein synthesis. 2014 PloS one Result HPV S207A;S243A 73;82 78;87 E2 96 98 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. However, in a re-ChIP assay for Brd4 binding, the S243A mutant had lost the ability to bind Brd4 (lane 5), whilst wild type E2 and S207A could bind to Brd4 and DNA to form a DNA-tethering complex (lane 3 and 4). 2014 PloS one Result HPV S243A;S207A 50;131 55;136 E2 124 126 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. However, S207A was able to associate with mitotic chromosomes, indicating that phosphorylation at serine 207 of the E2 protein is not required for tethering to host chromosomes during mitosis. 2014 PloS one Result HPV S207A 9 14 E2 116 118 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. However, the phosphor-mimetic substitution E2 mutants S243D and S243E associated with Brd4 and the metaphase. 2014 PloS one Result HPV S243D;S243E 54;64 59;69 E2 43 45 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. In summary, the S243A E2 protein has a shorter half-life than the wild type and S207A E2, indicating that the HPV-16 E2 protein phosphorylated at serine 243 increases its half-life. 2014 PloS one Result HPV S243A;S207A 16;80 21;85 E2;E2;E2 22;86;117 24;88;119 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Meanwhile, the E2 mutants, such as S243A, S243N and S243Q, which are defective in Brd4 binding. 2014 PloS one Result HPV S243A;S243N;S243Q 35;42;52 40;47;57 E2 15 17 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Notably, there was a substantial reduction of signals from the S207A (lane 4) and S243A proteins (lane 5) and the hinge protein containing two amino acid substitutions (S207/243A) exhibited no detectable phosphorylation. 2014 PloS one Result HPV S207A;S243A 63;82 68;87 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. The residue serine 243 was substituted by glutamic acid (E) and aspartic acid (D) (named S243E and S243D respectively), which are negatively charged residues that mimic the effect of constitutive phosphorylation, or polar uncharged residues such as asparagine (N) and glutamine (Q) (named S243N and S243Q respectively). 2014 PloS one Result HPV S243E;S243D;S243N;S243Q 89;99;289;299 94;104;294;304 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. the wild type E2 proteins associated with Brd4 and were colocalized with the chromosomes throughout mitosis, but the S243A mutant E2 was not, which is consistent with the observation in COS-7 cells. 2014 PloS one Result HPV S243A 117 122 E2;E2 14;130 16;132 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. This indicates that S243A is deficient for mitotic binding and does not form mitotic chromosomal foci. 2014 PloS one Result HPV S243A 20 25 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. To elucidate whether these two residues are critical for chromosome binding by the HPV-16 E2 protein, we substituted each of these serine residues with alanine (named S207A and S243A) in the background of the full-length HPV-16 protein, to eliminate phosphorylation, and examined the localization of these E2 proteins on the mitotic chromosomes by confocal microscopy. 2014 PloS one Result HPV S207A;S243A 167;177 172;182 E2;E2 90;306 92;308 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. whilst the half-lives of the S207A and S243A proteins were 4 h and 2 h, respectively. 2014 PloS one Result HPV S207A;S243A 29;39 34;44 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. wild type E2 bound to the HPV-16 LCR promoter (lanes 3) and S207A and S243A also could bind to the HPV promoter, but to a lesser extent than wild type E2 (lane 4 and 5). 2014 PloS one Result HPV S207A;S243A 60;70 65;75 LCR;E2;E2 33;10;151 36;12;153 25483514 Anti-tumor effects of genetic vaccines against HPV major oncogenes. As shown in Figure 7A, tumor appearance was delayed to day 13 post challenge (p.c.) in 75% of the pcDNA3-E7GGG-CP treated animals, in 60% of mice vaccinated with pcDNA3-E6F47R-CP and pCI-E5H16, and in 40% of the pCI-E5Multi vaccinated mice. 2015 Human vaccines & immunotherapeutics Result HPV F47R 171 175 E5;E6 187;169 189;171 25483514 Anti-tumor effects of genetic vaccines against HPV major oncogenes. In addition, two vaccines already produced against the E7 and E6 proteins, the pcDNA3-E7GGG-CP and the pcDNA3-E6F47R-CP, respectively, were utilized for comparison. 2015 Human vaccines & immunotherapeutics Result HPV F47R 112 116 E6;E6;E7 62;110;55 64;112;57 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The E6F47R protein was expressed at higher levels by CEFs (5.8-fold) and Vero cells (4.4-fold) than by MRC-5 cells, as determined by densitometric analysis. 2015 Journal of translational medicine Result HPV F47R 6 10 E6 4 6 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. The FPE6F47R and the pDNAE6F47R recombinants correctly express the E6F47R transgene. 2015 Journal of translational medicine Result HPV F47R 69 73 E6 67 69 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. E-C183/G350, E-C306/G350 and E-G535/G350 show polymorphisms that so far have not been reported, E-C183/G350 leads to the amino acid change I27T, E-C306/G350 changes K68T and E-G535/G350 does not lead to any amino acid change (Table 1). 2015 Virology journal Result HPV I27T;K68T 139;165 143;169 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. All African lines showed a common pattern of five characteristic mutations in E6, namely, C143G, G145T, T286A, A289G, and C335T, which lead to two non-synonymous amino acid changes Q14D and H78Y. 2015 Infectious agents and cancer Result HPV C143G;G145T;T286A;A289G;C335T;Q14D;H78Y 90;97;104;111;122;181;190 95;102;109;116;127;185;194 E6 78 80 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. An undescribed mutation was found in three sequences in this study at nt 622, that was generated a non-synonymous nucleotide change G622A (D21N). 2015 Infectious agents and cancer Result HPV G622A;D21N 132;139 137;143 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. However, the common non-synonymous mutation A to G transition at nt 647 and causing amino acid change N29S, was found in 3 (23.0%) out of 13 sequences. 2015 Infectious agents and cancer Result HPV A647G;N29S 44;102 71;106 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. In E7, all HPV-16 isolates showed a common pattern of two silent mutations namely T789C and T795G at codons 76 and 78 respectively. 2015 Infectious agents and cancer Result HPV T789C;T795G 82;92 87;97 E7 3 5 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The most frequently observed variations were C143G (Q14D), G145T (Q14D), T286A, A289G and C335T (H78Y), which was found in all samples. 2015 Infectious agents and cancer Result HPV C143G;Q14D;G145T;Q14D;T286A;A289G;C335T;H78Y 45;52;59;66;73;80;90;97 50;56;64;70;78;85;95;101 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The most frequently observed variations were the common silent mutations T789C and T795G at codons 76 and 78, which was found in all E7 sequences. 2015 Infectious agents and cancer Result HPV T789C;T795G 73;83 78;88 E7 133 135 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. -61.67 for V8R and -54.60 for V8V, where as in for V16R and V16V were -49.55 and 50.86, respectively. 2015 Scientific reports Result HPV V8R;V8V;V16R;V16V 11;30;51;60 14;33;55;64 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. In 13 biallaelic variations, six variations C6163A(V1), G6171A(V2), C6240G(V3), A6432G(V6), G6693A(V8) and C6863T(V11) were missense and seven variations T6245C(V4), A6314G(V5), C6557T(V7), G6719A(V9), C6852T(V10), C6968T(V14) and A6293C(V15) were silent. 2015 Scientific reports Result HPV C6163A;G6171A;C6240G;A6432G;G6693A;C6863T;T6245C;A6314G;C6557T;G6719A;C6852T;C6968T;A6293C 44;56;68;80;92;107;154;166;178;190;202;215;231 50;62;74;86;98;113;160;172;184;196;208;221;237 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. In V8V, the replacement of threonine (T) by proline (P) caused the loss of hydrogen bond. 2015 Scientific reports Result HPV V8V 3 6 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. It causes a change from G to T corresponding to a change in L500F amino acid in ~25% of the samples. 2015 Scientific reports Result HPV L500F 60 65 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. On further analysis, it was observed that variations V3, V12 and V13 were observed in all HPV 16 positive samples (100%), which correspond to amino acid change from histidine to aspartate at position H228D, an insertion of serine residue at 448 and deletion of aspartate residue at 465 position respectively (Table 1). 2015 Scientific reports Result HPV H228D 200 205 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. The best docked model having lowest global energy for V16R, V16V, 8R and 8V were selected and visualized in chimera. 2015 Scientific reports Result HPV V16R;V16V 54;60 58;64 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. The comparison of respective reference and the variant peptide showed a new hydrogen bond in case of V16V and loss of hydrogen bond in case of V8V, which also causes change in global energy i.e. 2015 Scientific reports Result HPV V8V;V16V 143;101 146;105 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. The in-silico analysis showed the replacement of threonine by proline at 379 causing distortion of a sheet structure (disappeared), that may be due to the unusual structure of proline. 2015 Scientific reports Result HPV T379P 49 76 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. Therefore, we prepared DNA vaccine construct for L500F (V16) variation, which was found in the vicinity of HEC regions amino acid 469-493 on the L1 capsid protein of HPV. 2015 Scientific reports Result HPV L500F 49 54 L1 145 147 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. V6 corresponding to change in amino acid at T292A was found in ~97% of the samples. 2015 Scientific reports Result HPV T292A 44 49 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. Variations V1, V2, V8 and V11 led to change in amino acid at T202N, A205T, T292A, T379P, P435L, respectively and was found in ~25% of the same samples. 2015 Scientific reports Result HPV T202N;A205T;T292A;T379P;P435L 61;68;75;82;89 66;73;80;87;94 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. We observed 16 major variations (V1-V16) in full length L1 (Table 1); 13 biallelic variations, one trialleic [G7058A/T(V16)] and two frameshift variations; one insertion [ATC insertion at C6901(V12)] and one deletion [deletion of GAT 6590(V13)]. 2015 Scientific reports Result HPV G7058T;G7058A 110;110 118;118 L1 56 58 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. About 80 % of skin biopsies of K14-HPV8-E6K136N mice collected at 3, 5, 13 and 24 days after treatment showed a gammaH2AX staining intensity comparable to FVB/n-wt, while about 20 % showed a staining pattern similar to K14-HPV8-E6wt, a staining pattern that was comparable to the tumor rate found in these animals. 2015 Molecular cancer Result HPV K136N 42 47 E6 40 42 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Impaired p300 binding by HPV8-E6K136N. 2015 Molecular cancer Result HPV K136N 32 37 E6 30 32 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. In contrast, expression of the HPV5-E6K138N mutant that was impaired for inhibition of T^T repair did not alter the phosphorylation patterns of either ATR or Chk1. 2015 Molecular cancer Result HPV K138N 38 43 E6 36 38 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Of the E6 mutants tested, only K138N was severely impaired in its ability to interfere with T^T repair (K138N versus E6wt, p = 0.0057; K138N versus control, p = 0.07; student t-test), while all other mutants showed an activity that was similar to that of the wild-type HPV5-E6 protein (HPV5-E6wt versus control, p = 0.0032, student t-test). 2015 Molecular cancer Result HPV K138N;K138N;K138N 31;104;135 36;109;140 E6;E6 7;274 9;276 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Significantly more T^T positive cells persisted in the skin of K14-HPV8-E6wt compared to FVB/n-wt control (p < 0.0001) and K14-HPV8-E6-K136N mutant mice (p = 0.0003). 2015 Molecular cancer Result HPV K136N 135 140 E6 132 134 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Since K136 lies within the p300-binding domain of HPV8-E6 we analysed whether HPV8-E6K136N still interacts with p300 in keratinocytes. 2015 Molecular cancer Result HPV K136N 85 90 E6;E6 55;83 57;85 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. Since the mRNA levels of E6 play an important role in papilloma induction after UV treatment, we compared the E6 expression levels in K14-HPV8-E6wt and K14-HPV8-E6K136N mouse lines. 2015 Molecular cancer Result HPV K136N 163 168 E6;E6;E6 25;110;161 27;112;163 Papilloma 54 63 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. The aa substitution of K136N in HPV8-E6 did not affect binding to MAML1 and SMAD3. 2015 Molecular cancer Result HPV K136N 23 28 E6 37 39 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. To exclude that missing binding to p300 resulted from a changed tertiary structure of HPV8-E6K136N, the ability of the mutant protein to bind to the known cellular target proteins MAML1 and SMAD3 was studied. 2015 Molecular cancer Result HPV K136N 93 98 E6 91 93 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. To study the impact of E6 on DDR mediated sensing of DNA damage early after UVB treatment, cell lines expressing HPV5-E6wt, HPV5-E6K138N or HPV8-E6wt were generated and treated with camptothecin (CPT, a DNA damaging agent that generates DSBs), or irradiated with 5 mJ/cm2 UVB. 2015 Molecular cancer Result HPV K138N 131 136 E6;E6 23;129 25;131 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. We then generated a K14-HPV8-E6K136N transgenic mouse model (K136 in HPV8-E6 corresponds to HPV5-E6-K138) to examine whether UV-induced skin tumor development is impaired in these animals. 2015 Molecular cancer Result HPV K136N 31 36 E6;E6;E6 29;74;97 31;76;99 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. While all K14-HPV8-E6wt mice developed papillomas within 3 weeks post irradiation, only 22 % of K14-HPV8-E6K136N mice showed skin tumor formation, but in 78 % of E6 mutant mice the skin had healed completely. 2015 Molecular cancer Result HPV K136N 107 112 E6;E6 105;162 107;164 Papilloma;Skin tumor 39;125 49;135 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. While HPV8-E6wt bound p300, the mutant HPV8-E6K136N nearly completely lost the ability to complex with p300. 2015 Molecular cancer Result HPV K136N 46 51 E6 44 46 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. HPV16 E6 gene T350G polymorphism. 2016 Cancer medicine Result HPV T350G 14 19 E6 6 8 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Interestingly, this increase in affinity is afforded by the L391F mutation alone. 2016 Scientific reports Result HPV L391F 60 65 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Since the increased affinity of PDZO9 for all peptides measured is due to the L391F mutation in the hydrophobic pocket, a Phe at position 391 likely contributes to the favourable free energy of binding first of all through increased hydrophobic interaction with the p0 side chain and/or increased burial of hydrophobic surface. 2016 Scientific reports Result HPV L391F 78 83 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Since the L391F mutation alone instead yielded Kd values comparable to that for PDZO9, the measurable coupling enables a scenario where the presence of L391F compensates for the effect of K392M. 2016 Scientific reports Result HPV L391F;L391F;K392M 10;152;188 15;157;193 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. The K392M mutation has either no effect, or, as for EKKHTLL, VSKETPL and TSRETDL, results in a slight decrease in affinity. 2016 Scientific reports Result HPV K392M 4 9 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. The L391F mutation alone provides the increased affinity that PDZO9 displays for all selected peptides. 2016 Scientific reports Result HPV L391F 4 9 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. The set of nine selected peptides (see Table 1) and the HPV18 E6 peptide RRRETQV, which PDZO9 was engineered to have high affinity for, were subjected to binding studies with pWT PDZ2, pWT PDZ2 L391F, pWT PDZ2 K392M, and PDZO9, respectively, using stopped-flow spectroscopy. 2016 Scientific reports Result HPV L391F;K392M 194;210 199;215 E6 62 64 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. These are the same three peptides for which the K392M single mutation in pWT PDZ2 resulted in a slight decrease in affinity. 2016 Scientific reports Result HPV K392M 48 53 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. Following on from our previous experiments showing that BPV1 E2 associates with ChlR1 and that mutation of tryptophan 130 to arginine (W130R) abrogates ChlR1 binding, we aimed to determine whether this interaction surface is conserved in the HPV16 E2 protein. 2017 Journal of virology Result HPV W130R;W130R 135;107 140;133 E2;E2 61;248 63;250 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. This was somewhat surprising because the Y131A mutation is not within the known nuclear localization signals in E2. 2017 Journal of virology Result HPV Y131A 41 46 E2 112 114 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. To determine the biological significance of the interaction between E2 and ChlR1 in the HPV16 life cycle, the Y131A mutation was introduced into the E2 open reading frame of the HPV16 genome, and recircularized viral genomes were transfected into primary human foreskin keratinocytes (HFKs) harvested from two independent donors. 2017 Journal of virology Result HPV Y131A 110 115 E2;E2 68;149 70;151 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. Lineage C also harbored lineage-specific variations (Table 3), of which an E6 nonsynonymous mutation (L83V, concurrent mutations of C348G and G350T) and five E7 nonsynonymous mutations, S52D (concurrent mutations of A706G and G707A), Y55D (T727G), H61Y (C733T), D64N (G742A) and L99R (T848G), showed significant associations with the lineage (P < 0.0001). 2016 PloS one Result HPV L83V;C348G;G350T;S52D;A706G;G707A;Y55D;T727G;H61Y;C733T;D64N;G742A;L99R;T848G 102;132;142;186;216;226;234;240;248;254;262;268;279;285 106;137;147;190;221;231;238;245;252;259;266;273;283;290 E6;E7 75;158 77;160 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. Of the 91 samples, K93R (A379G), the most frequently detected nonsynonymous mutation (85.71%) in E6, was only found in lineage B. 2016 PloS one Result HPV K93R;A379G 19;25 23;30 E6 97 99 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. In addition, there were no non-synonymous mutations in the HPV-58 E6 sequences encoding the alpha helix or the beta sheet; while three non-synonymous mutations (T74A, D76E, and V77A) occurred in HPV-58 E7 sequences encoding the alpha helix. 2017 PloS one Result HPV T74A;D76E;V77A 161;167;177 165;171;181 E6;E7 66;202 68;204 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. In addition, two biallelic mutations and one triallelic (C706A/T) mutation were found over the 294-bp E7 ORF, resulting in 4 amino acid changes of S29T, A45V, A45E, and Q97L (Table 1). 2017 PloS one Result HPV C706T;C706A;S29T;A45V;A45E;Q97L 57;57;147;153;159;169 64;64;151;157;163;173 E7 102 104 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. K93N and R145 (I/N) of HPV-33 and HPV-58 E6 were observed at the same two positions. 2017 PloS one Result HPV K93N 0 4 E6 41 43 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. The positively selected sites for HPV-33 E6 were K35N, K93N, and R145I; for HPV-33 E7 were S29T, A45V, A45E, and Q97L; for HPV-58 E6 were K93N, R145K; and for HPV-58 E7 were T20I, G41R, G63S, and G63D. 2017 PloS one Result HPV K35N;K93N;R145I;S29T;A45V;A45E;Q97L;K93N;R145K;T20I;G41R;G63S;G63D 49;55;65;91;97;103;113;138;144;174;180;186;196 53;59;70;95;101;107;117;142;149;178;184;190;200 E6;E6;E7;E7 41;130;83;166 43;132;85;168 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. Two non-synonymous mutations (S74T and Q113R) occurred in the HPV-33 E6 sequences encoding the alpha helix. 2017 PloS one Result HPV S74T;Q113R 30;39 34;44 E6 69 71 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Also, the nucleotide variations A86G, and C188T were detected in cervical samples. 2017 Asian Pacific journal of cancer prevention Result HPV A86G;C188T 32;42 36;47 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 The common variant detected from all the cervical samples was T234G, but it did not lead to any amino acid (Threonine) change. 2017 Asian Pacific journal of cancer prevention Result HPV T234G 62 67 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 The results demonstrated that the most predominant variant was C196T which led to an amino acid change of R66W in 72.39% of the specimens. 2017 Asian Pacific journal of cancer prevention Result HPV C196T;R66W 63;106 68;110 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 These variations induce the amino acid changes N29S, and S63F, respectively. 2017 Asian Pacific journal of cancer prevention Result HPV N29S;S63F 47;57 51;61 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. Additionally, the variation sites such as A7233C and C7395T were only detected in cervical cancer (Table 2 and S1 Table). 2017 PloS one Result HPV A7233C;C7395T 42;53 48;59 Cervical carcinoma 82 97 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. Furthermore, the variations of C7310T, C7395T and C7886G were predicted to locate at the binding site for CCAAT/enhancer binding protein beta (CEBPB), ETS proto-oncogene 1 (ETS1) and signal transducer and activator of transcription 3 (STAT3), respectively. 2017 PloS one Result HPV C7310T;C7395T;C7886G 31;39;50 37;45;56 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7193T and G7521A variants, which accounted for 100% of the infections, were located at the binding site for Forkhead box protein A1 (FOXA1) and sex-determining region Y-box 9 (SOX9), respectively. 2017 PloS one Result HPV G7193T;G7521A 0;11 6;17 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The mutation frequency varied from 2% (1/48) to 100% (48/48), among which the G7193T and G7521A variants got a mutation frequency of 100%. 2017 PloS one Result HPV G7193T;G7521A 78;89 84;95 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The other common LCR changes were A7730C, A7175C, T7177C, T7201C, C7270T, G7842A, C24T, A7287C and A7289C with mutation frequencies of approximately 71% (34/48), 65% (31/48), 65% (31/48), 65% (31/48), 65% (31/48), 65% (31/48), 65% (31/48), 63% (30/48) and 46% (22/48), respectively. 2017 PloS one Result HPV A7730C;A7175C;T7177C;T7201C;C7270T;G7842A;C24T;A7287C;A7289C 34;42;50;58;66;74;82;88;99 40;48;56;64;72;80;86;94;105 LCR 17 20 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The variations of A7730C contributed to influence the binding of paired-like homeobox 2a (PHOX2A). 2017 PloS one Result HPV A7730C 18 24 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. When compared with the asymptomatic carriers, A7175C, T7177C, T7201C, C7270T, A7287C, A7289C, A7730C, G7842A and C24T got higher mutation frequencies in cervical cancer. 2017 PloS one Result HPV A7175C;T7177C;T7201C;C7270T;A7287C;A7289C;A7730C;G7842A;C24T 46;54;62;70;78;86;94;102;113 52;60;68;76;84;92;100;108;117 Cervical carcinoma 153 168 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. While, the mutations C24T and C31T within 1 to 82 nucleotides of the HPV-16 LCR were not predicted to affect the binding sites of transcription factors. 2017 PloS one Result HPV C24T;C31T 21;30 25;34 LCR 76 79 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. 4 and Table S3 in the supplemental material) and E1 A1965T within the MRCA of A variants (Br10) may represent ancient adaptation or fitness in archaic hominins. 2017 Journal of virology Result HPV A1965T 52 58 E1 49 51 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. A genome-wide association analysis using mutual information (MI) examination identified three additional amino acid changes within L2 (N231T and M446L) and L1 (L5F); 16 synonymous nucleotide mutations within E1, NCR2, L2, L1, and the LCR; and a 12-bp insertion within the LCR as being strongly associated with the E7 T20I/G63S variant (Table 2). 2017 Journal of virology Result HPV L5F;N231T;M446L;T20I;G63S 160;135;145;317;322 163;140;150;321;326 LCR;LCR;E1;E7;L1;L1;L2;L2 234;272;208;314;156;222;131;218 237;275;210;316;158;224;133;220 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. For example, E7 G760A within B1 variants (branch 3 [Br3] in. 2017 Journal of virology Result HPV G760A 16 21 E7 13 15 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. For example, the A3 sublineage-specific nucleotide variations of E7 C632T (amino acid T20I); E1 C1965T; E2 A3685G; NCR2 A4192C; L2 G4570A, A4609G, and A4935C (N231T); L2/L1 A5579C (L2 M446L or L1 L5F); L1 T5747C; and LCR G7147T, G7194C, A7304G, A7714C, and A7755G are highly correlated and represent fixed changes in natural selection when sublineage A3 split from its most recent common ancestor (MRCA). 2017 Journal of virology Result HPV L5F;C632T;T20I;C1965T;A3685G;A4192C;G4570A;A4609G;A4935C;N231T;A5579C;M446L;T5747C;G7147T;G7194C;A7304G;A7714C;A7755G 196;68;86;96;107;120;131;139;151;159;173;184;205;221;229;237;245;257 199;73;90;102;113;126;137;145;157;164;179;189;211;227;235;243;251;263 LCR;E1;E2;E7;L1;L1;L1;L2;L2;L2 217;93;104;65;170;193;202;128;167;181 220;95;106;67;172;195;204;130;169;183 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. Interestingly, some sites associated with the E7 T20I/G63S variant that carries higher carcinogenicity had mutated earlier than the time of the divergence of the A3 sublineage. 2017 Journal of virology Result HPV G63S;T20I 54;49 58;53 E7 46 48 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. Lineage fixation and genomic signatures associated with E7 T20I/G63S. 2017 Journal of virology Result HPV G63S;T20I 64;59 68;63 E7 56 58 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. Overall, the A3 sublineage represented by a high-risk E7 T20I/G63S variant was most common (26.9%) in Asia and, to a lesser extent, was common in America (9.1%) and Europe (4.1%) but was absent in Africa. 2017 Journal of virology Result HPV G63S;T20I 62;57 66;61 E7 54 56 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. The E7 T20I/G63S variant conferring higher risks for cervical precancer and cancer represents the A3 sublineage. 2017 Journal of virology Result HPV G63S;T20I 12;7 16;11 E7 4 6 Cervical carcinoma 53 71 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. Among them, 5 were non-synonymous amino acids variations including A6693C observed in 18 cases, G6800A in 2 cases, G6818A in 2 cases. 2017 Bioinformation Result HPV A6693C;G6800A;G6818A 67;96;115 73;102;121 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. In Helice 2 region, the two mutations Met/Ile at position 425 and Met/Ile at position 431 are not significant as compared to the reference sequence. 2017 Bioinformation Result HPV M425I;M431I 38;66 61;89 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. In the third pattern, reported in only 2 cases, all non-synonymous mutations were reported (Thr389Pro, Met424Ile, Met430Ile, ATC insertion at position 6901/6902 and the deletion of GAT at position 6950). 2017 Bioinformation Result HPV T389P;M424I;M430I 92;103;114 101;112;123 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. T389P amino acid substitution is located in the H-I loop; the two substitutions M424I and M430I are both located in the H2 helice. 2017 Bioinformation Result HPV T389P;M424I;M430I 0;80;90 5;85;95 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. The second pattern, reported in 16 cases, is characterized by the Thr389Pro change. 2017 Bioinformation Result HPV T389P 66 75 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. The Serine insertion at position 458/459 and aspartic acid deletion at position 475 are located in the H4 helice and B-C loop respectively. 2017 Bioinformation Result HPV del 475 59 83 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. C307T and A388C were identified in 36% variants (4/11). 2018 Virology journal Result HPV C307T;A388C 0;10 5;15 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. C321T and A388C resulted in the amino acid changes including S71F and K93 N, respectively. 2018 Virology journal Result HPV C321T;A388C;S71F;K93N 0;10;61;70 5;15;65;75 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. C7265G, C7266T and A7793G were the most variable sites and were identified in 27% of the variants (3/11). 2018 Virology journal Result HPV C7265G;C7266T;A7793G 0;8;19 6;14;25 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. G41R was affecting the MHC class-I binding peptide DEIGLDGPD (E7 35-43) and the MHC class-II binding peptide IGLDGPDGQ (E7 37-45). 2018 Virology journal Result HPV G41R 0 4 E7;E7 62;120 64;122 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. G63S/D was affecting the MHC classs-I binding peptide CYTCGTTVR (E7 59-67). 2018 Virology journal Result HPV G63D;G63S 0;0 6;6 E7 65 67 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. In the E7, 6 SNPs were detected (6/297, 2.0% nucleotide variation), of which T744G was identified in 64% variants (7/11), and 5 SNPs resulted in amino acid changes including T20I, G41R, G63S, G63D and V77A. 2018 Virology journal Result HPV T744G;T20I;G41R;G63S;G63D;V77A 77;174;180;186;192;201 82;178;184;190;196;205 E7 7 9 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. In the HPV-58 E6, a C to T substitution at the nucleotide site 321 led to the change of residue 71 (S to F) in one isolate, where the MHC class-I binding peptide KVCLRLLSK (E6 64-72) and the MHC class-II binding peptide LRLLSKISE (E6 67-75) were located. 2018 Virology journal Result HPV C321T 20 66 E6;E6;E6 14;173;231 16;175;233 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. In the HPV-58 E7, the non-synonymous substitution T20I was affecting the MHC class-I binding peptide HPEPTDLFC (E7 16-24) and the MHC class-II binding peptide LHPEPTDL (E7 15-22). 2018 Virology journal Result HPV T20I 50 54 E7;E7;E7 14;112;169 16;114;171 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The A to C substitution at the nucleotide site 388 resulted in the change of residue 93 (K to N), where the MHC class-I binding peptide TLKKCLNEI (E6 91-99) was located. 2018 Virology journal Result HPV A388C 4 50 E6 147 149 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The non-synonymous variation V77A was detected in the E7 sequences encoding the alpha-helix. 2018 Virology journal Result HPV V77A 29 33 E7 54 56 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. V77A was affecting the MHC class-I binding peptide TTDVRTLQQ (E7 74-82) and the MHC class-II binding peptide VRTLQQLLM (E7 77-85). 2018 Virology journal Result HPV V77A 0 4 E7;E7 62;120 64;122 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. 3A showed that C7732G increased the transcriptional activity of LCR-PT by 80%, thus confirming its stimulatory effect in PHK. 2018 Scientific reports Result HPV C7732G 15 21 LCR 64 67 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. 4B showed that A7879G reduced the activity of LCR-PT by 35%, thus confirming that it represses the EP in HeLa cells. 2018 Scientific reports Result HPV A7879G 15 21 LCR 46 49 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. 5 shows that C7732T decreased the EP activity of LCR-PT by 25% in PHK, down to the level measured for LCR12, while A7874C had little to no effect. 2018 Scientific reports Result HPV C7732T;A7874C 13;115 19;121 LCR;LCR 49;102 52;105 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. A simple interpretation of these findings would be that the 79-bp region is transcriptionally active in PHK, but mostly silent in HeLa cells unless "potentiated" by the C7537A variation. 2018 Scientific reports Result HPV C7537A 169 175 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Although the contribution of the 79-bp region was modest in HeLa cells, it could be increased by the C7537A variation which lies within this region (compare 79del to 79del/C7537A in. 2018 Scientific reports Result HPV C7537A;C7537A;79del 101;172;157 107;178;162 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. As expected, C7732G also stimulated transcription from the LCR containing a single 79-bp region (compare 79del to 79del/C7732G in. 2018 Scientific reports Result HPV C7732G;C7732G 13;120 19;126 LCR 59 62 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. As for A7874C, it alters a nucleotide that is located only 5-bp away from the one changed by A7879G, thus raising the possibility that both variations affect the same DNA regulatory element. 2018 Scientific reports Result HPV A7874C;A7879G 7;93 13;99 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. As for the enhancing role of the 79del/C7537A combination in HeLa cells. 2018 Scientific reports Result HPV C7537A 39 45 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Because C7537A lies in the 79-bp region, it has been technically challenging to introduce it into only one of the two identical 79-bp regions of LCR-PT by site directed mutagenesis. 2018 Scientific reports Result HPV C7537A 8 14 LCR 145 148 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. C7732T affects the same nucleotide as C7732G, changing it for a T rather than a G residue. 2018 Scientific reports Result HPV C7732T;C7732G 0;38 6;44 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Collectively, these results highlighted the repressive effect of A7879G on the EP and its antagonistic relationship with 79del/C7537A in HeLa cells. 2018 Scientific reports Result HPV A7879G;C7537A 65;127 71;133 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Figure 3A also shows that the loss of one of the two 79-bp regions in LCR-PT (79del) reduced EP activity by 50% in PHK, and that removal of both copies (2 x 79del) had an even more severe effect, reducing transcription by 70%. 2018 Scientific reports Result HPV 79del 157 162 LCR 70 73 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Furthermore, whereas C7732T stimulated EP activity in HeLa cells, C7732G had no significant effect. 2018 Scientific reports Result HPV C7732T;C7732G 21;66 27;72 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Given that LCR4, LCR8 and LCR9 differ from LCR7 only by the presence of T7404del, 7529Ins and TA7412del, respectively, this suggests that these variations do not contribute substantially to the activity of the EP in both cell types. 2018 Scientific reports Result HPV T7404del;TA7412del 72;94 80;103 LCR;LCR;LCR;LCR 11;17;26;43 14;20;29;46 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Hence, we opted to always study this variation in combination with 79del (79del/C7537A) throughout this study, as both variations are always found together in A1-sublineage variants (Table 1). 2018 Scientific reports Result HPV C7537A;79del 80;67 86;72 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Importantly, they also validated the notion that A7879G opposes the stimulatory effect of 79del/C7537A in these cells (compare 79del/C7537A and 3xMut in. 2018 Scientific reports Result HPV A7879G;C7537A;C7537A 49;96;133 55;102;139 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, C7732G had no significant effect in HeLa cells when introduced into LCR-PT, with or without 79del. 2018 Scientific reports Result HPV C7732G 13 19 LCR 81 84 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, E2 activated the variant reporter 5.6-fold suggesting that A7874C enhances the affinity of E2 for this site. 2018 Scientific reports Result HPV A7874C 72 78 E2;E2 13;104 15;106 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, reversion of A7879G nearly double the activity of the EP, indicating that this variation represses the promoter. 2018 Scientific reports Result HPV A7879G 26 32 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, the plasmid containing the variant A7874C 4 x E2BS reduced E2-transactivation of the reporter gene in a dose-dependent manner. 2018 Scientific reports Result HPV A7874C 48 54 E2 72 74 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In summary, the results presented above indicate that C7732T represses the EP in PHK, in contrast to C7732G which activates it. 2018 Scientific reports Result HPV C7732T;C7732G 54;101 60;107 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In the current study, we selected eight of these variants for further investigation, focusing on those containing the 79del and/or C7732G variation (LCR 4, 5, 6, 7, 8, 9, 12 and 14 in). 2018 Scientific reports Result HPV C7732G;79del 131;118 137;123 LCR 149 152 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In this cell line, C7732T has little to no effect while A7874C was repressive, reducing EP activity by 50% when introduced in LCR-PT. 2018 Scientific reports Result HPV C7732T;A7874C 19;56 25;62 LCR 126 129 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Increasing amounts of each plasmid were tested for their ability to inhibit transactivation of the 4 x E2BS-Fluc A7874C reporter by E2. 2018 Scientific reports Result HPV A7874C 113 119 E2 132 134 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. LCR12 contains only two variations, C7732T and A7874C, that are unique to the A1 sublineage and are reminiscent of the A2-specific variations C7732G and A7879G investigated above. 2018 Scientific reports Result HPV C7732T;A7874C;C7732G;A7879G 36;47;142;153 42;53;148;159 LCR 0 3 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Likewise, introduction of A7874C in LCR-PT is identical to reversion of C7732T in LCR12. 2018 Scientific reports Result HPV A7874C;C7732T 26;72 32;78 LCR;LCR 36;82 39;85 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Notably, the effects of C7732T on the EP were quite different than those of the C7732G variation, which are shown in. 2018 Scientific reports Result HPV C7732T;C7732G 24;80 30;86 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Note that since LCR12 contains only 2 variations, introducing C7732T in LCR-PT is equivalent to reverting A7874C in LCR12. 2018 Scientific reports Result HPV C7732T;A7874C 62;106 68;112 LCR;LCR;LCR 16;72;116 19;75;119 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Our previous characterization of natural HPV33 LCR variants isolated from cervical samples revealed that a deletion of one copy of the duplicated 79-bp region (79del), was associated with persistent infections, and that the C7732G variation was associated with HSIL in our cohort population. 2018 Scientific reports Result HPV C7732G;79del 224;160 230;165 LCR 47 50 Squamous intraepithelial lesions 261 265 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Reversion of either C7743T, C7537A or C6G had little to no effect on the strength of the EP. 2018 Scientific reports Result HPV C6G;C7743T;C7537A 38;20;28 41;26;34 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Similarly, we constructed mutant LCR-PT derivatives in which one or both copies of the 79-bp region were removed by site-directed mutagenesis (79del and 2 x 79del, respectively). 2018 Scientific reports Result HPV 79del;79del 143;157 148;162 LCR 33 36 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Since the single 79-bp region of A2-sublineage LCRs contains the C7537A variation, we also introduced 79del and C7537A together in LCR-PT. 2018 Scientific reports Result HPV C7537A;C7537A;79del 65;112;102 71;118;107 LCR;LCR 47;131 51;134 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Specifically, we introduced C7732G in LCR-PT, either alone or in combination with 79del, as found in the A2-variants LCR6 and LCR14. 2018 Scientific reports Result HPV C7732G;79del 28;82 34;87 LCR;LCR;LCR 38;117;126 41;120;129 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Specifically, we investigated the contribution of the four A2-specific variations, C7443T, C7537A, A7879G and C6G, by reverting them individually back to the sequence of the prototype. 2018 Scientific reports Result HPV C6G;C7443T;C7537A;A7879G 110;83;91;99 113;89;97;105 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Stated otherwise, reversion of C7732T increased the activity of LCR12 by 75% whereas reversion of A7874C had no effect on this LCR. 2018 Scientific reports Result HPV C7732T;A7874C 31;98 37;104 LCR;LCR 64;127 67;130 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Taken together, these results indicate that the A7874C variation enhances the binding and activity of E2 at E2BS2. 2018 Scientific reports Result HPV A7874C 48 54 E2 102 104 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The 79-bp duplication appears to be less important in HeLa cells where deletion of one copy (79del) had little to no effect on the EP and removal of both copies (2 x 79del) only reduced its activity by 25%. 2018 Scientific reports Result HPV 79del;79del 93;166 98;171 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The A7874C variation characterized above is located within a sequence that corresponds to E2 binding site 2 (E2BS2) of the HPV33 LCR (7866-ACCGTTTTAGGT-7877, A7874 underlined. 2018 Scientific reports Result HPV A7874C 4 10 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The enhancing activity of 79del/C7537A on the EP is antagonized by A7879G in HeLa cells. 2018 Scientific reports Result HPV C7537A;A7879G 32;67 38;73 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The findings that the HPV33 EP is strengthened by C7732G in PHK (LCR6 vs LCR5 in. 2018 Scientific reports Result HPV C7732G 50 56 LCR;LCR 65;73 68;76 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The HSIL-associated C7732G variation and 79-bp duplication increase EP activity in PHK. 2018 Scientific reports Result HPV C7732G 20 26 Squamous intraepithelial lesions 4 8 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The only notable exception was the 30% lower activity of LCR4 compared to LCR7 in HeLa cells (p <= 0.01), which could be attributed to the TA7412del variation, the sole difference between both LCRs (Table 1). 2018 Scientific reports Result HPV TA7412del 139 148 LCR;LCR;LCR 57;74;193 60;77;197 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The possibility that the stimulatory effect of 79del/C7537A in HeLa cells is masked by other variations in A2-sublineage LCRs prompted us to perform a reversion analysis of LCR6, which contains this double variation. 2018 Scientific reports Result HPV C7537A 53 59 LCR;LCR 121;173 125;176 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The two A1-specific variations C7732T and A7874C have opposite effects on EP activity. 2018 Scientific reports Result HPV C7732T;A7874C 31;42 37;48 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. These results indicate that C7732T represses EP-driven transcription in PHK. 2018 Scientific reports Result HPV C7732T 28 34 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. These results suggested that A7879G may be the variation that antagonizes the enhancing effect of 79del/C7537A in HeLa cells. 2018 Scientific reports Result HPV A7879G;C7537A 29;104 35;110 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. They also show that A7874C represses the EP in HeLa cells, similarly to A7879G. 2018 Scientific reports Result HPV A7874C;A7879G 20;72 26;78 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Third, since LCR6 and LCR14 displayed virtually identical activities in both PHK and HeLa cells, and only differ by the presence of A7686C in LCR14, we surmise that this variation has little to no effect on EP activity in both cell types. 2018 Scientific reports Result HPV A7686C 132 138 LCR;LCR;LCR 13;22;142 16;25;145 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. This can be attributed to the C7732G variation which is the only difference between LCR6 and LCR5 and is also present in LCR14. 2018 Scientific reports Result HPV C7732G 30 36 LCR;LCR;LCR 84;93;121 87;96;124 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. This could possibly be the 79del variation that is found in all A2- and B-lineage LCRs but absent from the two A1-lineage LCRs. 2018 Scientific reports Result HPV 79del 27 32 LCR;LCR 82;122 86;126 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. This raises the possibility that additional polymorphisms in A2-sublineage variants counteract the stimulatory effect of 79del/C7537A in HeLa cells, as examined below. 2018 Scientific reports Result HPV C7537A 127 133 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Thus, the presence of A7879G in LCR5, LCR6 and LCR14 LCRs (Table 1) explains why these A2-sublineage LCRs were not more active than the prototype in HeLa cells, even though they contain 79del/C7537A. 2018 Scientific reports Result HPV A7879G;C7537A 22;192 28;198 LCR;LCR;LCR;LCR;LCR 32;38;47;53;101 35;41;50;57;105 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. To determine the contribution of C7732T and A7874C to the EP activity of LCR12, we introduced them individually into the prototype and measured the transcriptional activities of the resulting mutant derivatives. 2018 Scientific reports Result HPV C7732T;A7874C 33;44 39;50 LCR 73 76 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. To test if this variation affects the activity of E2 at this site, we constructed two firefly luciferase reporter genes under the control of four consecutive E2BS2 (4 x E2BS) either of the prototype sequence or containing the A7874C variation. 2018 Scientific reports Result HPV A7874C 226 232 E2 50 52 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. To test this possibility directly, A7879G was introduced into LCR-PT either by itself or together with 79del/C7537A; the LCR-PT derivative carrying all three variations (A7879G/79del/C7537A) being termed 3xMut. 2018 Scientific reports Result HPV A7879G;C7537A;C7537A;A7879G 35;109;183;170 41;115;189;176 LCR;LCR 62;121 65;124 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. To verify this prediction, competition assays were performed with two plasmids carrying the four E2BS of the prototype and A7874C variant sequence, respectively, and lacking the Fluc ORF. 2018 Scientific reports Result HPV A7874C 123 129 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Transactivation by the viral E2 protein is enhanced by the A1-specific A7874C variation. 2018 Scientific reports Result HPV A7874C 71 77 E2 29 31 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. While C7732G certainly accounts for the higher activity of LCR6 and LCR14 in PHK, compared to LCR5, the 79-bp duplication present only in LCR-PT and in LCR12 likely contributes to their higher activities in these primary cells. 2018 Scientific reports Result HPV C7732G 6 12 LCR;LCR;LCR;LCR;LCR 59;68;94;138;152 62;71;97;141;155 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. While C7732T reduced EP activity in PHK, C7732G activated transcription in these cells, as noted earlier. 2018 Scientific reports Result HPV C7732T;C7732G 6;41 12;47 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. Of these, 23 (74.2%) had a base pair substitution at the E350G position, with this change being the most prevalent. 2018 The Indian journal of medical research Result HPV E350G 57 62 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Among them, E7 T20I/G63S (V1) is of our particular interest, due to its stronger association with cervical cancers compared to other variants.27 In view of these, we first wanted to predict whether the two amino acid substitutions T20I and G63S in the V1 variant confer any possible functional importance based on their location within the HPV58 E7 protein. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S;T20I;G63S 15;20;231;240 19;24;235;244 E7;E7 12;346 14;348 Cervical carcinoma 98 114 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Collectively, our results implied that HPV58 E7 prototype and V1 (T20I/G63S) preferentially degraded pRb over other pocket proteins; and did not confer additional oncogenicity through p107/p130 targeting. 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 71;66 75;70 E7 45 47 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Confocal microscopy showed that HPV58 E7 prototype predominantly localized in the nucleus with a punctate pattern and could also be found in the cytoplasm, whereas HPV16 E7 distributed evenly throughout the cell in both cytoplasm33 and nucleus.34 Subsequent subcellular localisation studies revealed that all the three other HPV58 E7 variants, including V1 (T20I/G63S), displayed similarly nuclear punctates as prototype (Figure 4). 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 363;358 367;362 E7;E7;E7 38;170;331 40;172;333 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Consistently, we observed that V1A (T20I) and V1B (G63S) can degrade pRb at a similar level as V2 (G43R/G63D) and V3 (T74A/T76E), even though at a weaker extent compared to V1 (T20I/G63S). 2019 Journal of cellular and molecular medicine Result HPV V1A;T20I;G63S;G43R;G63D;T74A;T76E;G63S;T20I 31;36;51;99;104;118;123;182;177 34;40;55;103;108;122;127;186;181 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. However, it is perhaps worth noticing that both HPV58 E7 prototype and V1 (T20I/G63S) can degrade p130 at a better extent compared to HPV16 E7 and other HPV58 E7 variants in this experimental setting. 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 80;75 84;79 E7;E7;E7 54;140;159 56;142;161 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. HPV58 E7 T20I/G63S variant increased anchorage-independent growth in soft agar. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S 9;14 13;18 E7 6 8 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. HPV58 E7 T20I/G63S variant increased primary murine epithelial cells immortalisation. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S 9;14 13;18 E7 6 8 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. HPV58 E7 V1 (T20I/G63S) degraded pRb more promptly, alike HPV58 E7 prototype. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S 13;18 17;22 E7;E7 6;64 8;66 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. In line with our previous epidemiological observations, the HPV58 E7 V1 (T20I/G63S) variant displayed a higher colony-forming ability by 45 +- 25% on day 14 of the immortalisation assay when compared with prototype (P < 0.05) and other variants in BRK cells suggesting that it has a higher immortalising and transforming potential (Figure 2). 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 78;73 82;77 E7 66 68 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. It seems that single amino acid variation of either T20I or G63S may not be sufficient to induce full transformation, while amino acid alteration at both sites allows HPV58 E7 to achieve higher transforming ability compared to other HPV58 E7 variants. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S 52;60 56;64 E7;E7 173;239 175;241 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. On day 14, HPV58 E7 V1 (T20I/G63S) variant and prototype demonstrated a significantly higher colony number by 93 +- 2% and 76 +- 2%, respectively, compared with other variants (P < 0.0001) (Figure 3A,B). 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 29;24 33;28 E7 17 19 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. On the other hand, G41R/G63D and T74A/D76E are located downstream of CR2, near or within CR3 of E7, which is further away from the important LXCXE motif (Figure 1A,B). 2019 Journal of cellular and molecular medicine Result HPV G41R;G63D;T74A;D76E 19;24;33;38 23;28;37;42 E7 96 98 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Our previous epidemiological data collected from 401 HPV58-containing clinical samples worldwide revealed that the three most common circulating E7 strains were variants containing the amino acid alterations: G41R/G63D (V2; 51%), T20I/G63S (V1; 22%) and T74A/D76E (V3; 14%)27 (Figure 1A). 2019 Journal of cellular and molecular medicine Result HPV G63D;G41R;T20I;G63S;T74A;D76E 214;209;230;235;254;259 218;213;234;239;258;263 E7 145 147 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Our results demonstrated that the HPV58 E7 V1 (T20I/G63S) variant attained a stronger ability to induce anchorage-independent growth and possessed a higher transforming ability, similar to prototype when compared to other E7 variants. 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 52;47 56;51 E7;E7 40;222 42;224 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Prototype HPV58 E7 had a significantly shorter half-life of 19.0 +- 2.6 minutes (Figure 5A,B), and all the three HPV58 E7 variants, including V1 (T20I/G63S), had similar half-lives to the prototype of approximately 19 minutes (ranging from 18.20 +- 2.31 to 21.14 +- 1.21 minutes). 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 151;146 155;150 E7;E7 16;119 18;121 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. The HPV58 E7 V1 (T20I/G63S) and prototype induced markedly greater degradation of exogenous pRb than other variants by 26 +- 3% and 25 +- 3% respectively (P < 0.001, Figure 6A). 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 22;17 26;21 E7 10 12 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. This again indicated that both T20I and G63S were important for pRb recognition and hence, could contribute to higher oncogenic properties of V1. 2019 Journal of cellular and molecular medicine Result HPV T20I;G63S 31;40 35;44 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. We then proceeded to characterize the possible underlying molecular mechanism contributing to the higher transforming potential of HPV58 E7 V1 (T20I/G63S) and prototype as demonstrated in the soft agar assay. 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 149;144 153;148 E7 137 139 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. We then sought to determine the oncogenic potential of HPV58 E7 V1 (T20I/G63S) experimentally through phenotypic assays. 2019 Journal of cellular and molecular medicine Result HPV G63S;T20I 73;68 77;72 E7 61 63 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Whilst the two artificial mutants, E7 V1A (T20I) and V1B (G63S) showed similar number of colonies, and at similar levels as V2 (G41R/G63D) and V3 (T74A/D76E). 2019 Journal of cellular and molecular medicine Result HPV V1A;T20I;G63S;G41R;G63D;T74A;D76E 38;43;58;128;133;147;152 41;47;62;132;137;151;156 E7 35 37 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. 2 that T7791C activates the LCR10 EP in these cells. 2019 Scientific reports Result HPV T7791C 7 13 LCR 28 31 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Collectively, the in vitro studies presented above identified two high-affinity C/EBPbeta binding sites in the HPV33 LCR, BS1 and BS2, and revealed that the former is inactivated by the T7791C variation in LCR10. 2019 Scientific reports Result HPV T7791C 186 192 LCR;LCR 117;206 120;209 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Collectively, these results indicate that T7791C is the main variation that activates the LCR10 EP in C33A, HeLa and U2OS cells. 2019 Scientific reports Result HPV T7791C 42 48 LCR 90 93 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. G18A also decreased, albeit slightly, the EP activity of LCR7 in C33A (p <= 0.001) and HeLa (p <= 0.01) cells. 2019 Scientific reports Result HPV G18A 0 4 LCR 57 60 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Importantly, C/EBPbeta-bZIP bound very poorly to the T7791C variant site and to the negative control mBS1 site (Ki > 1000 nM. 2019 Scientific reports Result HPV T7791C 53 59 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In C33A, HeLa and U2OS cells, however, reversion of T7791C decreased the activity of LCR10 by 40-60%, down to the levels measured for the prototype. 2019 Scientific reports Result HPV T7791C 52 58 LCR 85 88 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In C33A, HeLa and U2OS cells, only the revertant LCRs lacking T7791C showed lower activity, thus confirming the results from. 2019 Scientific reports Result HPV T7791C 62 68 LCR 49 53 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In summary, these results indicated that T7791C represses the EP in combination with T7365C and C7531T in PHK, and is sufficient to activate the EP in C33A, HeLa and U2OS cells. 2019 Scientific reports Result HPV T7791C;T7365C;C7531T 41;85;96 47;91;102 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. lacking T7365C, C7531T and T7791C) is nearly identical in sequence to LCR7, the only difference being the presence of an additional variation in LCR7, G18A. 2019 Scientific reports Result HPV T7365C;C7531T;T7791C;G18A 8;16;27;151 14;22;33;155 LCR;LCR 70;145 73;148 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Like mBS1, T7791C also stimulated the EP in C33A, HeLa and U2OS cells. 2019 Scientific reports Result HPV T7791C 11 17 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Next, we measured the affinities (Ki) of GST-C/EBPbeta-bZIP for competitor oligonucleotides containing either the binding site found in LCR-PT (BS1), the variant BS1 (BS1-T7791C), or a defective BS1 that was inactivated by four mutations (mBS1; negative control). 2019 Scientific reports Result HPV T7791C 171 177 LCR 136 139 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Reversion of T7365C and C7531T, in contrast, had little to no effect. 2019 Scientific reports Result HPV T7365C;C7531T 13;24 19;30 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C accounts for the enhanced EP activity of LCR10 in C33A, HeLa and U2OS cells. 2019 Scientific reports Result HPV T7791C 0 6 LCR 48 51 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C changes a DNA sequence that resembles a binding site for the transcription factor C/EBPbeta; we termed this site BS1 in LCR-PT and BS1-T7791C in LCR10 (sequence shown in. 2019 Scientific reports Result HPV T7791C;T7791C 0;142 6;148 LCR;LCR 127;152 130;155 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C was also introduced alone into LCR-PT for comparison with mBS1. 2019 Scientific reports Result HPV T7791C 0 6 LCR 38 41 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The combination of T7791C, T7365C and C7531T in LCR10, and the G18A variation in other B-lineage LCRs repress the EP in PHK. 2019 Scientific reports Result HPV T7791C;T7365C;C7531T;G18A 19;27;38;63 25;33;44;67 LCR;LCR 48;97 51;101 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The fact that individual reversion of T7791C, T7365C or C7531T did not alter the activity of LCR10 in PHK prompted us to investigate if reverting these variations in combination would have an effect. 2019 Scientific reports Result HPV T7791C;T7365C;C7531T 38;46;56 44;52;62 LCR 93 96 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The results presented above suggested that the T7365C, C7531T and/or T7791C variations may contribute to the higher transcriptional activity of LCR10 compared to the other four B-lineage LCRs. 2019 Scientific reports Result HPV T7365C;C7531T;T7791C 47;55;69 53;61;75 LCR;LCR 144;187 147;191 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The T7791C variation affects one of two binding sites for the transcription factor C/EBPbeta. 2019 Scientific reports Result HPV T7791C 4 10 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The transcriptional activity of LCR7 was approximately 5-fold weaker than that of the LCR10 triple revertant in PHK (p <= 0.01), indicating that G18A represses the EP of LCR7 in these cells. 2019 Scientific reports Result HPV G18A 145 149 LCR;LCR;LCR 32;86;170 35;89;173 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. These results showed that C/EBPbeta can bind specifically to BS1 in vitro but that this site is inactivated by the T7791C variation and mBS1 mutation. 2019 Scientific reports Result HPV T7791C 115 121 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. These results suggest that T7791C, T7365C and C7531T act together to repress the activity of the LCR10 EP in PHK. 2019 Scientific reports Result HPV T7791C;T7365C;C7531T 27;35;46 33;41;52 LCR 97 100 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. They also showed that the absence of G18A in LCR10 contributes to its higher transcriptional activity compared to the other B-lineage variants which all contain this variation (Table 1). 2019 Scientific reports Result HPV G18A 37 41 LCR 45 48 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. This allowed the effect of G18A on the EP to be examined by comparing the transcriptional activity of LCR7 to that of the LCR10 triple revertant. 2019 Scientific reports Result HPV G18A 27 31 LCR;LCR 102;122 105;125 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Three of those variations, T7365C, C7531T and T7791C are not found in other B-lineage LCRs and may therefore account for the higher transcriptional activity of LCR10, as tested below. 2019 Scientific reports Result HPV T7365C;C7531T;T7791C 27;35;46 33;41;52 LCR;LCR 86;160 90;163 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. While clearly highlighting a functional difference between T7791C and mBS1 in PHK, this result is nevertheless consistent with the finding that reversion of T7791C in LCR10 had little effect on its transcriptional activity unless combined with reversion of T7365C and T7791. 2019 Scientific reports Result HPV T7791C;T7791C;T7365C 59;157;257 65;163;263 LCR 167 170 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Among the results of LCR sequencing, 33 polymorphic sites were found (the Table lists only 29 sites), of which four polymorphic sites (G7191T, nt7432-7433:GC to CGG, G7518A and A7861 deletions) showed 100% mutation in 95 samples. 2019 Cancer cell international Result HPV G7191T;G7518A 135;166 141;172 LCR 21 24 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Compared with E6, the E7 gene is more conserved; the most common mutation site in E7 was A647G (18/75, 24%), and only one sample of A645C and A646C showed mutation. 2019 Cancer cell international Result HPV A647G;A645C;A646C 89;132;142 94;137;147 E6;E7;E7 14;22;82 16;24;84 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Nineteen single nucleotide changes were identified among the sequencing results for E6 and E7, including 14 missense mutations and five synonymous mutations: 11/14 missense mutations were distributed in the E6 gene (C168G, G176A, T178G, T178A, T183G, A275G, A276G, T295G, T350G, C360A and A442C) and 3/14 missense mutations (A645C, A646C, A647G) were located in the E7 gene. 2019 Cancer cell international Result HPV C168G;G176A;T178G;T178A;T183G;A275G;A276G;T295G;T350G;C360A;A442C;A645C;A646C;A647G 216;223;230;237;244;251;258;265;272;279;289;325;332;339 221;228;235;242;249;256;263;270;277;284;294;330;337;344 E6;E6;E7;E7 84;207;91;366 86;209;93;368 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Notably, 18 cases of the A647G mutation were combined with the T178G mutation, and we considered that the A647G of E7 and T178G of E6 were co-variations. 2019 Cancer cell international Result HPV A647G;T178G;A647G;T178G 25;63;106;122 30;68;111;127 E6;E7 131;115 133;117 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. The most common mutation sites in HPV16 E6 were T350G (36/75, 48%) and T178G (19/75, 25.3%). 2019 Cancer cell international Result HPV T350G;T178G 48;71 53;76 E6 40 42 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. The remaining 29 mutations were mainly T7447C (39/95, 40.1%), followed by T7199C (16/95, 16.8%), C7268T (16/95, 16.8%), A7285C (16/95, 16.8%), T7711G (16/95, 16.8%), A7727C (16/95, 16.8%), G7839A (16/95, 16.8%) and C24T (16/95, 16.8%). 2019 Cancer cell international Result HPV T7447C;T7199C;C7268T;A7285C;T7711G;A7727C;G7839A;C24T 39;74;97;120;143;166;189;215 45;80;103;126;149;172;195;219 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. The two synonymous mutations of the E6 gene were nt109 (T to C) and nt 131 (A to C). 2019 Cancer cell international Result HPV A131C 71 83 E6 36 38 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. These caused the amino acid to change from threonine to serine (T22S), aspartic acid to asparagine (D25N), aspartic acid to glutamic acid (D25E), aspartic acid to glutamine (D25Q), isoleucine to arginine (I27R), asparagine to aspartic acid (N58D), asparagine to serine (N58S), aspartic acid to glutamic acid (D64E), leucine to valine (L83V), threonine to lysine (T86K), glutamic acid to aspartic acid (E113D), leucine to phenylalanine (L28F), asparagine to histidine (N29H) and asparagine to serine (N29S), respectively. 2019 Cancer cell international Result HPV E113D;T22S;D25N;D25E;D25Q;I27R;N58D;N58S;D64E;L83V;T86K;L28F;N29H;N29S 402;64;100;139;174;205;241;270;309;335;363;436;468;500 407;68;104;143;178;209;245;274;313;339;367;440;472;504 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. We also found that six loci, T7199C, C7268T, A7285C, A7727C, G7839A, and C24T, in the LCR sequence were possibly co-variations. 2019 Cancer cell international Result HPV T7199C;C7268T;A7285C;A7727C;G7839A;C24T 29;37;45;53;61;73 35;43;51;59;67;77 LCR 86 89 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. After sequence analysis of the 25 HPV6 samples, it was noted that 12 (48%) samples belong to the HPV6B3 (L42216) variant and that all of these samples presented the G474A mutation compared to the prototype E6 sequence. 2019 Advances in virology Result HPV G474A 165 170 E6 206 208 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. Analysis of seven HPV11 samples revealed that all samples belong to the HPV11A2 variant but only the sample BR_CA28_A2 showed the nucleotide alteration T410C (Table 3) compared to the sequence LP19 (accession number: FN870447) classified as HPV11A2 by Burk et al., 2011. 2019 Advances in virology Result HPV T410C 152 157 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Among these mutations, T921C (T19T), A1041G (L59L), C1096G (Q78E), G1163A (G100E), T1200C (A112A), T1366A (C168S), C1426G (Q188E), T1486C (L208L), T1522A (S220T), C1624T (L154L), A1668G (A268A), C1744A (L294M), C2041T (L393L), G2220C (E452D), C2237G (T458S), G2249A (R462K), C2262T (G466G), C2287T (L475L), T2586C (S574S), A2608C (R582R), T2631A (P589P) and G2650A (E596K) were found only in the HPV16 D3 (AA1) sub-lineage; T933A (A23A) and T1014G (D50E) were observed only in the A4 (As) sub-lineage; A2547G (P561P) was found only in the A1-A3 (EUR) sub-lineage; G2160A (R432R) and T2232C(F456F) was found in both the A4 (As) and A1-A3 (EUR) sub-lineages. 2019 International journal of medical sciences Result HPV T921C;T19T;A1041G;L59L;C1096G;Q78E;G1163A;G100E;T1200C;A112A;T1366A;C168S;C1426G;Q188E;T1486C;L208L;T1522A;S220T;C1624T;L154L;A1668G;A268A;C1744A;L294M;C2041T;L393L;G2220C;E452D;C2237G;T458S;G2249A;R462K;C2262T;G466G;C2287T;L475L;T2586C;S574S;A2608C;R582R;T2631A;P589P;G2650A;E596K;T933A;A23A;T1014G;D50E;A2547G;P561P;G2160A;R432R;T2232C;F456F 23;30;37;45;52;60;67;75;83;91;99;107;115;123;131;139;147;155;163;171;179;187;195;203;211;219;227;235;243;251;259;267;275;283;291;299;307;315;323;331;339;347;358;366;424;431;441;449;502;510;564;572;583;590 28;34;43;49;58;64;73;80;89;96;105;112;121;128;137;144;153;160;169;176;185;192;201;208;217;224;233;240;249;256;265;272;281;288;297;304;313;320;329;336;345;352;364;371;429;435;447;453;508;515;570;577;589;595 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. For the D3 (AA1) sub-lineage, which occurred only in the case group, a total of twenty-eight mutations with a frequency of 100% were found; except for T1139G (V92G), C1377T (Y171Y), A1842G (I326M), T2254C (L464L), T2343C (F493F) and C2344T (L494L), these mutations occurred only in the D3 (AA1) sub-lineage. 2019 International journal of medical sciences Result HPV T1139G;V92G;C1377T;Y171Y;A1842G;I326M;T2254C;L464L;T2343C;F493F;C2344T;L494L 151;159;166;174;182;190;198;206;214;222;233;241 157;163;172;179;188;195;204;211;220;227;239;246 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Furthermore, the C878A (A5E), T969C (D35D), T1152C (S96S), A1395T (G177G), T1447G (L195V), T1602C (S246S), T2040C (F392F), A2535C (L557L) and A2547G (P561P) mutations were found only in the control group. 2019 International journal of medical sciences Result HPV C878A;A5E;T969C;D35D;T1152C;S96S;A1395T;G177G;T1447G;L195V;T1602C;S246S;T2040C;F392F;A2535C;L557L;A2547G;P561P 17;24;30;37;44;52;59;67;75;83;91;99;107;115;123;131;142;150 22;27;35;41;50;56;65;72;81;88;97;104;113;120;129;136;148;155 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. In the comparison of the distribution of these mutations between the case and control groups, we found that the distributions of the T2232C (F456F), G2337A (M491I) and A2547G (P561P) mutations were significantly different (P<0.05) (Table 2). 2019 International journal of medical sciences Result HPV T2232C;F456F;G2337A;M491I;A2547G;P561P 133;141;149;157;168;176 139;146;155;162;174;181 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Moreover, the T921C (T19T), T933A (A23A), T1014G (D50E), A1041G (L59L), C1096G (Q78E), G1163A (G100E), T1200C (A112A), T1366A (C168S), T1407G (S181R), C1426G (Q188E), T1486C (L208L), T1522A (S220T), C1624T (L154L), A1668G (A268A), C1744A (L294M), C2041T (L393L), G2220C (E452D), T2232C (F456F), C2237G (T458S), G2249A (R462K), C2262T (G466G), C2287T (L475L), T2567G (I568S), T2586C (S574S), A2608C (R582R), T2631A (P589P) and G2650A (E596K) mutations were found only in the case group. 2019 International journal of medical sciences Result HPV T921C;T19T;T933A;A23A;T1014G;D50E;A1041G;L59L;C1096G;Q78E;G1163A;G100E;T1200C;A112A;T1366A;C168S;T1407G;S181R;C1426G;Q188E;T1486C;L208L;T1522A;S220T;C1624T;L154L;A1668G;A268A;C1744A;L294M;C2041T;L393L;G2220C;E452D;T2232C;F456F;C2237G;T458S;G2249A;R462K;C2262T;G466G;C2287T;L475L;T2567G;I568S;T2586C;S574S;A2608C;R582R;T2631A;P589P;G2650A;E596K 14;21;28;35;42;50;57;65;72;80;87;95;103;111;119;127;135;143;151;159;167;175;183;191;199;207;215;223;231;239;247;255;263;271;279;287;295;303;311;319;327;335;343;351;359;367;375;383;391;399;407;415;426;434 19;25;33;39;48;54;63;69;78;84;93;100;109;116;125;132;141;148;157;164;173;180;189;196;205;212;221;228;237;244;253;260;269;276;285;292;301;308;317;324;333;340;349;356;365;372;381;388;397;404;413;420;432;439 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. The distributions of the T933A (A23A), T1014G (D50E) and G2160A (R432R) mutations were significantly different between the case and control group for the A4 (As) sub-lineage (Table 1). 2019 International journal of medical sciences Result HPV T933A;A23A;T1014G;D50E;G2160A;R432R 25;32;39;47;57;65 30;36;45;51;63;70 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. Among these variations, a total of eleven variations (A7167G, A7173C, C7176T, C7200T, T7269C, C7286A, C7729A, C7763T, A7841G, G7867A and T24C) were statistically significant between the case group and control group (P<0.05). 2020 International journal of medical sciences Result HPV A7167G;A7173C;C7176T;C7200T;T7269C;C7286A;C7729A;C7763T;A7841G;G7867A;T24C 54;62;70;78;86;94;102;110;118;126;137 60;68;76;84;92;100;108;116;124;132;141 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. However, A7173C showed a trend to associate with cervical cancer (P=0.074) in the A1-A3 (EUR) variants (case: 0% vs control: 15%). 2020 International journal of medical sciences Result HPV A7173C 9 15 Cervical carcinoma 49 64 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. The C7873G variation was significantly different between the case (8.3%) and control (18.4%) group (P=0.039), and the A7232C showed a trend to associate with cervical cancer (case: 0% vs control: 3.9%; P=0.068) in the HPV16 A4 (As) variant. 2020 International journal of medical sciences Result HPV C7873G;A7232C 4;118 10;124 Cervical carcinoma 158 173 32448303 Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea : Korean HPV18 variants and clinical manifestation. Among the 15 new nucleotide substitutions, 6 nonsynonymous amino acid substitutions were at positions 317, 443, 5467, 5560, 6462, and 6823 (F71L and N113K in E6; H13R, H44P, A345T, and N465S in L1, respectively). 2020 Virology journal Result HPV F71L;N113K;H13R;H44P;A345T;N465S 140;149;162;168;174;185 144;154;166;172;179;190 E6;L1 158;194 160;196 32448303 Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea : Korean HPV18 variants and clinical manifestation. Among them, 29 nucleotide substitutions were already reported: T104C, A171G, T173G, C287G, A482C, T485C, C549A, C554T, C751T, C860T, C5478T, A5497G, G5609A, T5619A, C5701G, C5875A, C5920T, A6059G, T6131G, T6146G, A6401G, A6430C, A6441C, C6460G, C6625G, C6842G, A6970G, and G7032A, and 15 nucleotide substitutions were newly identified: C158T of BRM05, T317G of BRM07, T443G of BRM08, A560G of BRM10, A5467G of BRM12, A5560C of BRM16, A5678C of BRM17, A6155G of BRM21, G6462A of BRM22, T6650G of BRM23, G6701A of BRM24, T6809C of BRM26, A6823G of BRM27, T6941C of BRM28, and T6953C of BRM36. 2020 Virology journal Result HPV T104C;A171G;T173G;C287G;A482C;T485C;C549A;C554T;C751T;C860T;C5478T;A5497G;G5609A;T5619A;C5701G;C5875A;C5920T;A6059G;T6131G;T6146G;A6401G;A6430C;A6441C;C6460G;C6625G;C6842G;A6970G;G7032A;C158T;T317G;T443G;A560G;A5467G;A5560C;A5678C;A6155G;G6462A;T6650G;G6701A;T6809C;A6823G;T6941C;T6953C 63;70;77;84;91;98;105;112;119;126;133;141;149;157;165;173;181;189;197;205;213;221;229;237;245;253;261;273;336;352;368;384;400;417;434;451;468;485;502;519;536;553;574 68;75;82;89;96;103;110;117;124;131;139;147;155;163;171;179;187;195;203;211;219;227;235;243;251;259;267;279;341;357;373;389;406;423;440;457;474;491;508;525;542;559;580 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. 11) was used to assess whether more than one type of L1-C175A or L1-C428A pentamer coexisted in the chVLPs. 2020 Nature communications Result HPV C175A;C428A 56;68 61;73 L1;L1 53;65 55;67 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. A mixture of the L1-C175A mutants or L1-C428A mutants of various genotypes or a mixture of the corresponding WT VLPs served as controls. 2020 Nature communications Result HPV C175A;C428A 20;40 25;45 L1;L1 17;37 19;39 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. and a trend that more unequal pairing (from 1:1.5, 1:2, and 1:4 of C175A:C428A mutants) led to poorer morphologies. 2020 Nature communications Result HPV C175A;C428A 67;73 72;78 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. and HPV16L1- and HPV59L1-C175A as a penta-type (along with HPV45L1-C175A and HPV52/58L1-C428A; Supplementary. 2020 Nature communications Result HPV C175A;C428A 67;88 72;93 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. As expected, the mixture of VLPs could not induce cross-genotype neutralization, whereas the chVLPs (HPV16L1-C175A-HPV52L1-C428A) significantly elicited a 1-2-log higher neutralization titer for HPV33 and -58. 2020 Nature communications Result HPV C428A;C175A 123;109 128;114 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. coli C175A and C428A mutants of three HPV types: HPV6, HPV16, and HPV52. 2020 Nature communications Result HPV C175A;C428A 5;15 10;20 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Consistent with our HPSEC profiles for equal molar ratios, chVLPs, confirmed to simultaneously harbor C175A and C428A pentamers. 2020 Nature communications Result HPV C175A;C428A 102;112 107;117 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Disulfide bond abundancies were measured as 8.8 +- 0.4, 16.1 +- 1.9, and 15.6 +- 0.6 mumol/g for HPV16L1-C175A-HPV52L1-C428A chVLPs, HPV16 VLP, and HPV52 VLP, respectively. 2020 Nature communications Result HPV C175A;C428A 105;119 110;124 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. First, mice were administered with di-type chVLPs (HPV16L1-C175A-HPV52L1-C428A) at 0.002, 0.008, 0.04, 0.2, 1.0, and 5.0 mug dosages, with a mixture of HPV16 and HPV52 VLPs at the same dosage serving as a control. 2020 Nature communications Result HPV C428A;C175A 73;59 78;64 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. First, we determined the stoichiometry of chVLPs using serial ratio arrays (orthogonal combinations of 1, 1.5, 2, and 4 molar ratios) of C175A and C428A mutants. 2020 Nature communications Result HPV C175A;C428A 137;147 142;152 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Following various input concentrations of HPV16L1-C175A and HPV52L1-C428A, we found that only equal molar ratios led to the favorable assembly of chVLPs. 2020 Nature communications Result HPV C175A;C428A 50;68 55;73 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. For capsomere-hybrid creation, we first created five tri-type permutations: HPV45/59L1-C175A-HPV52L1-C428A, HPV16/33L1-C175A-HPV58L1-C428A, HPV16/59L1-C175A-HPV52L1-C428A, HPV33L1-C175A-HPV16/58L1-C428A, and HPV45L1-C175A-HPV16/52L1-C428A. 2020 Nature communications Result HPV C428A;C175A;C428A;C175A;C428A;C175A;C428A;C175A;C428A;C175A 101;87;133;119;165;151;197;180;233;216 106;92;138;124;170;156;202;185;238;221 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. From this, we speculated that the deficiency in self-assembly could be partly rescued by reciprocity: if we combined Cys175Ala and Cys428Ala mutants in solution, binding could be achieved between the unmutated cysteine residue in each mutant L1. 2020 Nature communications Result HPV C175A;C428A 117;131 126;140 L1 242 244 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. However, the particle structures of these two types of capsomeres ascribed to HPV16L1-C175A and HPV52L1-C428A pentamers were indistinguishable at this lower resolution, and thus we could not identify their assembling scenarios and distributions within the chVLPs. 2020 Nature communications Result HPV C175A;C428A 86;104 91;109 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1- and HPV52L1-C428A as a tetra-type (with HPV45/59L1-C175A; Supplementary. 2020 Nature communications Result HPV C175A 60 65 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1- and HPV52L1-C428A as a tetra-type (with HPV45/59L1-C175A. 2020 Nature communications Result HPV C175A 60 65 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1- and HPV58L1-C428A also in a tri-type (with HPV33L1-C175A; Supplementary. 2020 Nature communications Result HPV C428A 21 26 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1- and HPV58L1-C428A also in a tri-type (with HPV33L1-C175A. 2020 Nature communications Result HPV C428A 21 26 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1- and HPV59L1-C175A as a penta-type (along with HPV45L1-C175A and HPV52/58L1-C428A. 2020 Nature communications Result HPV C175A 21 26 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. In particular, no spherical particles could be observed in the 1:4 or 4:1 ratio, which suggested that chVLPs comprise equal numbers of C175A and C428A mutant pentamers. 2020 Nature communications Result HPV C175A;C428A 135;145 140;150 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. In the differential scanning calorimetry (DSC) curves, HPV16 VLPs and HPV16L1-C175A pentamers possessed higher melting temperatures (Tm) ~5-10 C over that of HPV52: 68.9 C vs. 2020 Nature communications Result HPV C175A 78 83 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Interestingly, with the assistance of the L2 proteins same genotype as L1, either HPV16L1-C175A or HPV52L1-C428A alone could assemble into particles; albeit, with poor morphology in TEM. 2020 Nature communications Result HPV C175A;C428A 90;107 95;112 L1;L2 71;42 73;44 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Intriguingly, this strategy could be further extrapolated to the hybrid assembly of combinations bearing 4, 5, 6, and 7 types of HPV L1s that were rationed to have equal molar concentrations of C175A and C428A mutations. 2020 Nature communications Result HPV C175A;C428A 194;204 199;209 L1 133 136 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Intriguingly, we show that the two reciprocal forms of HPV16/52 chVLPs present different rEC50 profiles against the anti-HPV16 or HPV52 mAb panel, where the reactivity of HPV16L1-C175A-HPV52L1-C428A chVLPs is more susceptible to antibody binding upon hybrid-assembly than is the reciprocal chVLPs; this is shown by the greater decline in the reactivities against some of the anti-HPV16 and anti-HPV52 mAbs. 2020 Nature communications Result HPV C428A;C175A 193;179 198;184 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. It is noteworthy that these HPV16L1-C175A only and HPV52L1-C428A only particles assisted by L2 lost the ability to infect 239FT cells. 2020 Nature communications Result HPV C175A;C428A 36;59 41;64 L2 92 94 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Like WT HPV16 or HPV52 PsVs, the co-assembly of the HPV16L1-C175A and HPV52L1-C428A with the HPV16L2 or HPV52L2 (or both L2 proteins) led to good particle formation in the TEM and conferred marked infectivity in the fluorospot assay. 2020 Nature communications Result HPV C175A;C428A 60;78 65;83 L2 121 123 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Next, we raised mAbs through the immunization of mice with HPV16L1-C175A-HPV52L1-C428A chVLPs, and found that mAb 10C3 specifically targets chVLPs. 2020 Nature communications Result HPV C428A;C175A 81;67 86;72 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. On the other hand, HPV16/52 chVLPs exhibited two Tm peaks: one major peak was located at ~67 C, which was between the values for HPV16 and HPV52 VLPs, and a minor peak at ~60 C, between the values of C175A and C428A pentamers. 2020 Nature communications Result HPV C175A;C428A 202;212 207;217 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Our findings suggest that the reciprocal assembly of a chVLP by equal-molar pairing of C175A and C428A capsomers is independent of the specific L1 sequences and could theoretically contain up to 72 types of pentamers according to T = 7 icosahedral arrangement. 2020 Nature communications Result HPV C175A;C428A 87;97 92;102 L1 144 146 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. protein concentration indicated that HPV45L1- and HPV59L1-C175A co-assembled in a tri-type chVLP (with HPV52L1-C428A; Supplementary. 2020 Nature communications Result HPV C175A;C428A 58;111 63;116 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Similar to the results of the hybrid-assembly of chVLPs in vitro, individual HPV16L1-C175A or HPV52L1-C428A proteins could not assemble into particles in 293FT cells. 2020 Nature communications Result HPV C175A;C428A 85;102 90;107 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Taken together, the pairing of L1-C175A and L1-C428A mutants with L2 involvement leads to co-assembly in 293FT cells and rates of infectivity similar to that of WT HPV PsVs. 2020 Nature communications Result HPV C175A;C428A 34;47 39;52 L1;L1;L2 31;44;66 33;46;68 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. The chVLP fractions (~11.5 min retention time) in the HPSEC profiles of HPV16L1-C175A-HPV52L1-C428A and HPV52L1-C175A-HPV16L1-C428A were harvested and subjected to SDS-PAGE, western blotting, and double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) with type-specific monoclonal antibodies (mAbs). 2020 Nature communications Result HPV C428A;C175A;C428A;C175A 94;80;126;112 99;85;131;117 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. The cryo-EM structure of the HPV16L1-C175A-HPV52L1-C428A chVLP was determined at 26.1-A resolution (Supplementary Table 1) and compared with known structures of WT HPV16 and HPV52 VLPs (EMDB no. 2020 Nature communications Result HPV C175A;C428A 37;51 42;56 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. The reactivities of both HPV16L1-C175A-HPV52L1-C428A and HPV52L1-C175A-HPV16L1-C428A chVLPs were measured against three panels of mAbs using median effective concentration (EC50) calculations through ELISA; WT HPV16/HPV52 VLPs, HPV16L1-C175A/C428A pentamers, HPV52L1-C175A/C428A pentamers, HPV16L1-C175A-HPV16L1-C428A VLPs, and HPV52L1-C175A-HPV52L1-C428A VLPs served as controls. 2020 Nature communications Result HPV C428A;C175A;C428A;C175A;C428A;C175A;C428A;C175A;C428A;C175A;C428A;C175A 47;33;79;65;242;236;273;267;312;298;350;336 52;38;84;70;247;241;278;272;317;303;355;341 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. These three mutants were subjected to co-assembly, combining one or two types of C175A mixed with one or two types of C428A at equal molar ratios of C175A and C428A mutations. 2020 Nature communications Result HPV C175A;C428A;C175A;C428A 81;118;149;159 86;123;154;164 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Through particle-based analysis, we found that HPV16L1-C175A-HPV52L1-C428A chVLPs and the reciprocal VLPs (HPV52L1-C175A-HPV16L1-C428A) shared comparable retention times (~12 min), and both showed a single-component distribution in the HPSEC profiles. 2020 Nature communications Result HPV C428A;C175A;C428A;C175A 69;55;129;115 74;60;134;120 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. To assure favorable co-assembly, the expression levels of HPV16L1-C175A and HPV52L1-C428A were quantified by quantitative ELISA. 2020 Nature communications Result HPV C175A;C428A 66;84 71;89 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. To examine whether the hybrid-assembly of VLPs that form in vitro can be applied for HPV pseudoviruses (PsVs) generation in vivo, we introduced L1-C175A and L1-C428A mutations into the L1 gene and transfected this gene into 293FT cells, together with the L2 and GFP reporter genes for PsVs production, as described by Schiller. 2020 Nature communications Result HPV C175A;C428A 147;160 152;165 L1;L1;L1;L2 144;157;185;255 146;159;187;257 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Unexpectedly, one form of the nona-type chVLP (chVLP-1) did not induce detectable neutralizing antibody titers against HPV33 (Fig.聽8a鈥揷), although HPV33 L1 protein could be detected in the chVLP-1 particles (Supplementary Fig.聽14b, d), indicating a different assembly modality for certain genotype of L1 between C175A and C428A mutants involved in the chVLP assembly. 2020 Nature communications Result HPV C175A;C428A 312;322 317;327 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Using L1 proteins harboring either a Cys175Ala or a Cys428Ala (HPV16 numbering) mutation, we confirmed an inhibition of capsid formation, with the proteins folding as star-shaped pentamers that were incapable of self-assembling into HPV L1 VLPs. 2020 Nature communications Result HPV C175A;C428A 37;52 46;61 L1;L1 6;237 8;239 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. We found that HPVL1-C175A and -C428A mutants can pair-wise assemble for each of the three HPV types when combined. 2020 Nature communications Result HPV C175A;C428A 20;31 25;36 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. We next endeavored to assemble a single chVLP with more than two types of HPV L1 proteins bearing either the C175A or C428A mutations. 2020 Nature communications Result HPV C175A;C428A 109;118 114;123 L1 78 80 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. Overall, the results indicate that detected and missed HPV-59 variants are phylogenetically similar, but missed HPV-59 variants more often carry the A6562G SNP than do detected HPV-59 variants. 2020 Journal of clinical microbiology Result HPV A6562G 149 155 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. Specifically, HPV-59 variants bearing the A6562G SNP were significantly more likely to be missed by the SPF10 method (P = 0.0392). 2020 Journal of clinical microbiology Result HPV A6562G 42 48 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. It is worth noting that the mutation of S383G, which changed the polarity of side chain, is also located on the surface epitopes and presents in the isolates of BDG-163, a new L1 HPV-45 variant (Table 3 and Figure 4). 2020 Asian Pacific journal of cancer prevention Result HPV S383G 40 45 L1 176 178 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. Mutations of S49N, N81S, N379T, S383N and Q392H might not affect the antibody binding, since the structural properties between asparagine (N), threonine (T), serine (S), and glutamine (Q) are similarly polar. 2020 Asian Pacific journal of cancer prevention Result HPV S49N;N81S;N379T;S383N;Q392H 13;19;25;32;42 17;23;30;37;47 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. One sample (BDG-163) was consider as new variant with single nucleotide changed in nucleotide position 6705 from G to C compared to its closest isolate which originated from Costa Rica, Central America (Genbank accession number: EF202159.1). 2020 Asian Pacific journal of cancer prevention Result HPV G6705C 103 119 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. The change of polarity in amino acid side chains are reflected in I329T and S383G mutations. 2020 Asian Pacific journal of cancer prevention Result HPV I329T;S383G 66;76 71;81 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Although D153Y was almost undetectable on short exposure of the blot, longer exposure allowed the visualization of high molecular mass aggregates of this variant, which could not be resolved in the gel (data not shown), suggesting instability of D153Y in the cell. 2020 Frontiers in microbiology Result HPV D153Y;D153Y 9;246 14;251 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Among the E1 variants tested, M207I had a significantly reduced ability to support replication of the origin plasmid relative to the prototype E1, whereas Q142K and L262V yielded similar levels of replication (Figure 3A). 2020 Frontiers in microbiology Result HPV M207I;Q142K;L262V 30;155;165 35;160;170 E1;E1 10;143 12;145 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Among these substitutions, E1 L262V, E2 D153Y, E2 R302T, and L1 E52* were not found by BLAST search, and thus were newly identified variations. 2020 Frontiers in microbiology Result HPV E52X;L262V;D153Y;R302T 64;30;40;50 68;35;45;55 E1;E2;E2;L1 27;37;47;61 29;39;49;63 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. As shown in Figure 3G, while the prototype E2 completely suppressed the early promoter, D153Y and R302T failed to repress the viral promoter activity. 2020 Frontiers in microbiology Result HPV D153Y;R302T 88;98 93;103 E2 43 45 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Because all E2 proteins so far reported have a threonine residue at position 357, we examined E2 T357A instead of A357T. 2020 Frontiers in microbiology Result HPV T357A;A357T 97;114 102;119 E2;E2 12;94 14;96 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. In a titration experiment of the E1 expression plasmids, M207I showed a diminished ability to induce origin-dependent replication under the saturated amounts of the transfected plasmids when compared to the prototype (Figure 3C). 2020 Frontiers in microbiology Result HPV M207I 57 62 E1 33 35 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. In C33A cells, R302T was less efficiently expressed than the prototype E2, whereas the level of T357A was similar to that of the prototype. 2020 Frontiers in microbiology Result HPV R302T;T357A 15;96 20;101 E2 71 73 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. In contrast, T357A suppressed the promoter activity as efficiently as the prototype E2 did. 2020 Frontiers in microbiology Result HPV T357A 13 18 E2 84 86 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Indeed, DNA pulldown assay using the viral origin DNA revealed that R302T completely lost binding activity to the origin, whereas T357A kept such activity as similarly as the prototype E2 did (Figure 5B). 2020 Frontiers in microbiology Result HPV R302T;T357A 68;130 73;135 E2 185 187 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Of the 10 coding-region variations, nine were non-synonymous or missense substitutions, generating variant forms of viral proteins: E1 Q142K, E1 M207I, E1 L262V, E2 D153Y, E2 R302T, E2 A357T, E7 L65F, L1 E52* (*, nonsense mutation), and L2 N147D. 2020 Frontiers in microbiology Result HPV E52X;Q142K;M207I;L262V;D153Y;R302T;A357T;L65F;N147D 204;135;145;155;165;175;185;195;240 208;140;150;160;170;180;190;199;245 E1;E1;E1;E2;E2;E2;E7;L1;L2 132;142;152;162;172;182;192;201;237 134;144;154;164;174;184;194;203;239 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Regarding the E2 variants, D153Y and R302T exhibited a severely impaired ability to induce virus replication (Figure 3E). 2020 Frontiers in microbiology Result HPV D153Y;R302T 27;37 32;42 E2 14 16 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. The defect of D153Y in viral replication was thus explained by a low expression level of this variant in C33A cells. 2020 Frontiers in microbiology Result HPV D153Y 14 19 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Transfection of increasing amounts of the E2 expression plasmids for D153Y and R302T also resulted in significantly reduced levels of replication compared to the prototype E2 (data not shown). 2020 Frontiers in microbiology Result HPV D153Y;R302T 69;79 74;84 E2;E2 42;172 44;174 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Two E1/E2 variants, E1 K483A and E2 K111R, previously shown to be defective for viral replication, were included as negative controls. 2020 Frontiers in microbiology Result HPV K483A;K111R 23;36 28;41 E1;E1;E2;E2 4;20;7;33 6;22;9;35 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Western blot analysis showed comparable levels of protein expression for the prototype and R302T, and lower expression of T357A, whereas D153Y was almost undetectable as observed in C33A cells (Figure 3H). 2020 Frontiers in microbiology Result HPV R302T;T357A;D153Y 91;122;137 96;127;142 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. After obtaining the E7 model, we generated the variants with their respective mutations N29S (orange) and H51N (blue) in PyMOL, as seen in Figure 1C. 2021 International journal of molecular sciences Result HPV H51N;N29S 106;88 110;92 E7 20 22 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. Figure 1A shows that the changes in the N29S variant (blue) were located inside the CR2 region, and those of the H51N variant (orange) were in the CR3 region. 2021 International journal of molecular sciences Result HPV H51N;N29S 113;40 117;44 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. H51N Loses beta-Sheets throughout the Trajectory Simulation. 2021 International journal of molecular sciences Result HPV H51N 0 4 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. However, Figure 4B indicates that most of the secondary structures of N29S were preserved. 2021 International journal of molecular sciences Result HPV N29S 70 74 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. However, this fluctuation was highest for the H51N variant, and the fluctuation of N29S was minor with respect to the E7 reference. 2021 International journal of molecular sciences Result HPV H51N;N29S 46;83 50;87 E7 118 120 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. In contrast, H51N (blue) reached equilibrium after 20 ns and remained stable until 100 ns, but in the last 100 ns of the trajectory simulation, we observed an equilibrium period from 100 to 150 ns and then an oscillating pattern of approximately 2 A. 2021 International journal of molecular sciences Result HPV H51N 13 17 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. In the H51N variant, the LxCxE motif appeared to be maintained by a combination of hydrophobic interactions and electrostatic complementation, as it contained negative, neutral, and positive regions. 2021 International journal of molecular sciences Result HPV H51N 7 11 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. N29S (orange) reached equilibrium after 20 ns and remained stable throughout the trajectory simulation. 2021 International journal of molecular sciences Result HPV N29S 0 4 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. N29S Presents the Most Stable Trajectory Compared to the E7 Reference and H51N. 2021 International journal of molecular sciences Result HPV N29S;H51N 0;74 4;78 E7 57 59 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. PCA was performed to support the results of the MD simulation and to understand the structure and conformational changes of the E7 reference, N29S, and H51N by calculating the atomic fluctuation covariance matrix, shown in Figure 7A. 2021 International journal of molecular sciences Result HPV H51N;N29S 152;142 156;146 E7 128 130 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The E7 reference had a negative charge on the LxCxE motif (inside the green circle), while the N29S variant had not only a prominent negative charge, but also an electrostatically positive region and a neutral region. 2021 International journal of molecular sciences Result HPV N29S 95 99 E7 4 6 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The first 20 main components represented 72-75% of the total movement (72.5%, 73.9%, and 74.3% for the E7 reference, N29S, and H51N, respectively). 2021 International journal of molecular sciences Result HPV H51N;N29S 127;117 131;121 E7 103 105 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The H51N variant conserved the alpha-helix but lost the beta-sheets after 140 ns, shown in Figure 4C. 2021 International journal of molecular sciences Result HPV H51N 4 8 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The N29S variant had the most restricted movement, making it the most stable of the three protein systems. 2021 International journal of molecular sciences Result HPV N29S 4 8 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The N29S variant showed a more compact structure throughout the MD simulation than the E7 reference and the H51N variant, as seen in Figure 3C. 2021 International journal of molecular sciences Result HPV H51N;N29S 108;4 112;8 E7 87 89 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The N29S variant, Figure 3B, showed that 88.1% of the residues were in the favored region, while 10.7% were in the allowed region, and 1.2% were in the not-allowed region. 2021 International journal of molecular sciences Result HPV N29S 4 8 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The projection of PC1 and PC2 for each of the proteins (E7 reference, N29S, and H51N), as seen in Figure 7C-E, showed that the H51N variant presented more significant displacement, covering a wider range of space than the E7 reference and the N29S variant. 2021 International journal of molecular sciences Result HPV H51N;H51N;N29S;N29S 80;127;70;243 84;131;74;247 E7;E7 56;222 58;224 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The Rg between the E7 reference (green) and N29S (blue) showed similar compaction during dynamics, while the H51N (blue) variant exhibited an expansion in the final 50 ns of the trajectory simulation. 2021 International journal of molecular sciences Result HPV H51N;N29S 109;44 113;48 E7 19 21 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. These findings agree with the trajectory analysis, where N29S had the most stable RMSD, the lowest RMSF, and major compaction compared to the others. 2021 International journal of molecular sciences Result HPV N29S 57 61 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. These proteins have phosphorylation sites, and we used the SP2 structure patch to place the phosphorylation sites of S31 and 32 (in the reference and H51N) and S29, 31, and 32 (in N29S). 2021 International journal of molecular sciences Result HPV H51N;N29S 150;180 154;184 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. This behavior agreed with the RMSD and RMSF values, showing that H51N had the highest peak of fluctuation among the proteins. 2021 International journal of molecular sciences Result HPV H51N 65 69 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. This behavior on the trajectory of N29S may suggest the importance of the extra phosphorylation site on S29. 2021 International journal of molecular sciences Result HPV N29S 35 39 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. This outcome revealed that the mutation made the N29S variant more structurally stable than the E7 reference and H51N. 2021 International journal of molecular sciences Result HPV H51N;N29S 113;49 117;53 E7 96 98 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. To observe the structural changes between reference E7 and the variants, an alignment of the average structure of the reference E7 and the N29S and H51N variants was performed. 2021 International journal of molecular sciences Result HPV H51N;N29S 148;139 152;143 E7;E7 52;128 54;130 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. We performed an MD simulation of 200 ns to understand the effect of the mutations on the structural motion and stability of the E7 reference and the N29S and H51N variants. 2021 International journal of molecular sciences Result HPV H51N;N29S 158;149 162;153 E7 128 130 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. With respect to the H51N variant in Figure 3C, 90.8% of its amino acids were found in the favored region, 8.0% in the allowed region, and 1.1% in the not-allowed region. 2021 International journal of molecular sciences Result HPV H51N 20 24 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. A378C and A379G together led to the amino acid substitution of K93R. 2021 Virology journal Result HPV A378C;A379G;K93R 0;10;63 5;15;67 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. A801G and C751T were the most variable sites and were observed in 100% and 97.56% (40/41) of the samples, respectively. 2021 Virology journal Result HPV A801G;C751T 0;10 5;15 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. Also, T7933C and A7938G were the common variable sites and were observed in 36.59% (15/41) and 60.98% (25/41) of the samples, respectively. 2021 Virology journal Result HPV T7933C;A7938G 6;17 12;23 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. C662T, AG706/707GA, T727G, C733T, G742A and T848G, leading to the amino acids substitution of T37I, S52D, Y59D, H61Y, D64N and L99R, respectively. 2021 Virology journal Result HPV T37I;C662T;T727G;C733T;G742A;T848G;S52D;Y59D;H61Y;D64N;L99R 94;0;20;27;34;44;100;106;112;118;127 98;5;25;32;39;49;104;110;116;122;131 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. Due to K93R, the score of epitopes 89-104EERVKKPLSEITIRCI and 81-96YSLYGKTLEERVKKPL changed from 0.87 to 0.90 and 0.81 to 0.84, respectively; due to E3Q, the score of epitope 3-18EDPATRPRTLHELCEV changed from 0.68 to 0.74. 2021 Virology journal Result HPV E3Q;K93R 149;7 152;11 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. Due to K93R, there was a potentially affected on the epitope HLA-DPA1*02:01/DPB1*01:01. 2021 Virology journal Result HPV K93R 7 11 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. Due to T37I, S52D, Y59D, H61Y and D64N, the prediction epitopes of reference and variant sequences had some differences, only 4 prediction epitopes were completely consistent between reference and variant sequences, an increased high affinity epitope 44-59DGQAEQATDNYYIVTD was discovered in the variant sequences (the more details see Additional file 6: Table S12). 2021 Virology journal Result HPV T37I;S52D;Y59D;H61Y;D64N 7;13;19;25;34 11;17;23;29;38 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. Due to Y59D, H61Y and D64N, there were a potentially affected on the epitopes HLA-DRB3*02:02 and HLA-DQA1*01:02/DQB1*06:02. 2021 Virology journal Result HPV Y59D;H61Y;D64N 7;13;22 11;17;26 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G108C and A379G, leading to the amino acids substitution of E3Q and K93R, respectively. 2021 Virology journal Result HPV E3Q;G108C;A379G;K93R 60;0;10;68 63;5;15;72 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G350T and A379G were the most variable sites and were observed in 100% and 97.56% (40/41) of the samples, respectively. 2021 Virology journal Result HPV G350T;A379G 0;10 5;15 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G350T, G356A and A530G were synonymous mutation. 2021 Virology journal Result HPV G350T;G356A;A530G 0;7;17 5;12;22 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G7168C, C7207A, G7371, A7657C, A7865G and T13C were observed in 97.56% (40/41) of the samples. 2021 Virology journal Result HPV G7168C;C7207A;A7657C;A7865G;T13C 0;8;23;31;42 6;14;29;37;46 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G7622A and T7624G, G7861A and C7917A/G76C lead to increase the binding sites for FOXC1, RAX/VAX1/HOXA5/PHOX2A and FOXL1, respectively. 2021 Virology journal Result HPV G7622A;T7624G;G7861A;C7917A;G76C 0;11;19;30;37 6;17;25;36;41 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. G7622A, T7624G, T9659C, G7712C and G7861A were observed in all samples. 2021 Virology journal Result HPV G7622A;T7624G;T9659C;G7712C;G7861A 0;8;16;24;35 6;14;22;30;41 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. T573A, C751T and A801G were synonymous mutation. 2021 Virology journal Result HPV T573A;C751T;A801G 0;7;17 5;12;22 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A subset of the A2 sublineage appeared to be uniquely defined by the C335T (H85Y) and A442C (E120D) in E6 and A646C (N29H) in E7, and a subset of the A1 sublineage was uniquely defined by the C790T (R77C) in the E7 gene. 2021 BMC cancer Result HPV E120D;C335T;H85Y;A442C;A646C;N29H;C790T;R77C 93;69;76;86;110;117;192;199 98;74;80;91;115;121;197;203 E6;E7;E7 103;126;212 105;128;214 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Additionally, the substitution G823T at E7 leading to a premature stop codon occurred in an isolated CIN1 sample (16CNTZ53/A2), and follow-up for 3 years showed a normal cytology test. 2021 BMC cancer Result HPV G823T 31 36 E7 40 42 Cervical intraepithelial neoplasia 101 105 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Another nucleotide substitution was also found in nucleotide site 178, T178A (D32E), with the same amino acid change as T178G but belonging to the A3 (European) sublineage. 2021 BMC cancer Result HPV T178A;D32E;T178G 71;78;120 76;82;125 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. However, both C335T (H85Y) and A646C (N29H) non-synonymous substitutions appeared in 7% (21/298) of HPV16 isolates at the same time in this TZHPV study. 2021 BMC cancer Result HPV C335T;H85Y;A646C;N29H 14;21;31;38 19;25;36;42 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. It is worth noting that the insertion of ATAATC between nt561 and nt562 was first detected in the 16CNTZ64 variant, which accounted for 0.7% (2/298) of HPV16 isolates. 2021 BMC cancer Result HPV ins ATAATC 561-562 28 71 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Moreover, our data showed that the oncogenicity of HPV16 E6 T178G (D32E) and E7 A647G (N29S) variation was associated with an increased risk of CIN2+ (OR = 2.24 ~ 2.45) (Table 2). 2021 BMC cancer Result HPV T178G;D32E;A647G;N29S 60;67;80;87 65;71;85;91 E6;E7 57;77 59;79 Cervical intraepithelial neoplasia 144 148 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Notably, C335T (H85Y) was previously found to be specific to B/C/D lineages, and A646C (N29H) belongs to the A2 sublineage. 2021 BMC cancer Result HPV C335T;H85Y;A646C;N29H 9;16;81;88 14;20;86;92 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. The three most prevalent nucleotide substitutions were T178G (D32E) (191/298, 64.1%) in the E6 gene and A647G (N29S) (195/298, 65.4%) and T846C (192/298, 64.4%) in the E7 gene, which are specific to the A4 (Asian) sublineage. 2021 BMC cancer Result HPV T178G;D32E;A647G;N29S;T846C 55;62;104;111;138 60;66;109;115;143 E6;E7 92;168 94;170 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. To the best of our knowledge, the base substitutions of T100C, T105G(M8R), C110G(Q10E), G126A(R15Q), A134C(K18Q), T137G(L19V), A142G, A152G(T24A), A296C(K72Q), T310G(F76L), G373A, T412C, A430T, T434G(C118G), A452C, A473C, and T505G in E6 and A619T(T20S), C627T, A647C(N29T), G676C(D39H), T730C(F57L), G791T(R77L), and G823T(G88*) in E7 have never been reported in previous studies. 2021 BMC cancer Result HPV G88X;T100C;T105G;M8R;C110G;Q10E;G126A;R15Q;A134C;K18Q;T137G;L19V;A142G;A152G;T24A;A296C;K72Q;T310G;F76L;G373A;T412C;A430T;T434G;C118G;A452C;A473C;T505G;A619T;T20S;C627T;A647C;N29T;G676C;D39H;T730C;F57L;G791T;R77L;G823T 324;56;63;69;75;81;88;94;101;107;114;120;127;134;140;147;153;160;166;173;180;187;194;200;208;215;226;242;248;255;262;268;275;281;288;294;301;307;318 328;61;68;72;80;85;93;98;106;111;119;124;132;139;144;152;157;165;170;178;185;192;199;205;213;220;231;247;252;260;267;272;280;285;293;298;306;311;323 E6;E7 235;333 237;335 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. Among them, 8 specific mutations were missense mutation, including 83L>V (T350G) on the E6 gene, 219P>S (C3409T) on the E2 gene, 39I>L (A3977C) and 60I>V (A4040G) on the E5 gene, 43E>D (A4363T) and 330L>F (A5224C) on the L2 gene, 228H>D (C6240G) and 292 T>A (A6432G) on the L1 gene. 2021 Computational and structural biotechnology journal Result HPV T350G;C6240G;C3409T;A6432G;A5224C;A4363T;A4040G;P219S;I39L;I60V;E43D;L330F;H228D;T292A;L83V;A3977C 74;238;105;259;206;186;155;97;129;148;179;198;230;250;67;136 79;244;111;265;212;192;161;103;134;153;184;204;236;257;72;142 E2;E5;E6;L1;L2 120;170;88;274;221 122;172;90;276;223 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. H4 has 9 specific mutation sites (A2925G, C3409T, A3977C, A4040G, A4363T, G4936A, A5224C, A6432G, and G7191T), and H3 had one more mutation site (T350G) compared with H4, while H1 had two more mutation sites (T350G and T4226C) compared with H4 (Table 7, Table S2). 2021 Computational and structural biotechnology journal Result HPV T4226C;T350G;T350G;G7191T;G4936A;C3409T;A6432G;A5224C;A4363T;A4040G;A3977C;A2925G 219;209;146;102;74;42;90;82;66;58;50;34 225;214;151;108;80;48;96;88;72;64;56;40 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. The haplotype H2 had 5 specific mutation sites (A2925G, T4226C, A4363T, G4936A, and A5224C). 2021 Computational and structural biotechnology journal Result HPV T4226C;G4936A;A5224C;A4363T;A2925G 56;72;84;64;48 62;78;90;70;54 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. 1B demonstrates equivalent expression levels of E2-WT and E2-S23A in U2OS cells. 2021 mBio Result HPV S23A 61 65 E2;E2 48;58 50;60 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. 7 and 8 demonstrate an aberrant epithelium with the S23A cells compared with the wild type. 2021 mBio Result HPV S23A 52 56 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. A band of around 10 kbp was observed in HFK+HPV16-S23D-3. 2021 mBio Result HPV S23D 50 54 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. A striking feature of the SphI digest is that there is more DNA present in the HFK lines containing the S23A variant compared with the WT (compare lanes 7 to 9 with lanes 4 to 6). 2021 mBio Result HPV S23A 104 108 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Again, we got a striking phenotype with HFK+HPV16-S23A: all three keratinocyte cultures exhibited an attenuated initial immortalization, with slow growing colonies. 2021 mBio Result HPV S23A 50 54 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Agreeing with the gammaH2AX staining, there is a loss of viral genomes in the S23A samples as the cells migrate upwards through the epithelium. 2021 mBio Result HPV S23A 78 82 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Both E2-WT and E2-S23A were able to activate transcription from this reporter with no significant difference in activity. 2021 mBio Result HPV S23A 18 22 E2;E2 5;15 7;17 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Both of these results suggest that the S23A cells are not differentiating correctly compared with the wild-type cells. 2021 mBio Result HPV S23A 39 43 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Cell lines from all three donors containing HPV16-S23A samples exhibit significantly faster migrating bands compared with cells containing WT and S23D genomes (compare lanes 7 to 9 with the others). 2021 mBio Result HPV S23A;S23D 50;146 54;150 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. E2 can repress transcription from the HPV16 long control region (LCR), and E2-WT and E2-S23A were equally able to repress transcription from our pHPV16-LCR-luc reporter. 2021 mBio Result HPV S23A 88 92 LCR;LCR;E2;E2;E2 65;152;0;75;85 68;155;2;77;87 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Even in the basal layers, it is noticeable that there is less signal with the S23A samples compared to the wild-type cells. 2021 mBio Result HPV S23A 78 82 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Even though initial immortalization was attenuated, HFK+HPV16-S23A cells eventually grew out successfully. 2021 mBio Result HPV S23A 62 66 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 4A demonstrates expression of E2-WT and E2-S23A in the N/Tert-1 cells (compare lanes 2 and 3, respectively, with lane 1). 2021 mBio Result HPV S23A 50 54 E2;E2 37;47 39;49 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 5 clearly shows that the E2-S23A protein is detectable by immunofluorescence in these cells with a non-phospho-specific E2 antibody, and. 2021 mBio Result HPV S23A 35 39 E2;E2 32;127 34;129 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 6A shows an example for one of the HFK cultures 2 weeks following selection, crystal violet staining reveals the reduction in colony formation with HPV16-S23A compared with HPV16-WT and HPV16-S23D. 2021 mBio Result HPV S23A;S23D 161;199 165;203 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 6D summarizes the quantitation; there is a statistically significant increase in HPV16 genome copy number in the S23A samples compared to the WT. 2021 mBio Result HPV S23A 120 124 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 7A gives a representative image from hematoxylin and eosin (H&E) staining of the organotypic rafts from donor A containing the wild-type (WT) HPV16 and HPV16 S23A genomes. 2021 mBio Result HPV S23A 165 169 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Figure 9A demonstrates a lack of gammaH2AX staining in the S23A tissues that was statistically significantly reduced in two independent donor samples. 2021 mBio Result HPV S23A 59 63 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. However, with the S23A sample, there is a loss of E2 nuclear staining, although there is a background signal due to nonspecific interaction with the keratin (that has been "stripped" from the wild-type sample during processing). 2021 mBio Result HPV S23A 18 22 E2 50 52 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Immunoprecipitation brought down TopBP1 in all lines (lanes 4 to 6, top blot), but only E2-WT interacted strongly with TopBP1, demonstrating that the E2-S23A mutation also disrupted the E2-TopBP1 interaction in N/Tert-1 cells (compare lane 6 with lane 5). 2021 mBio Result HPV S23A 153 157 E2;E2;E2 88;150;186 90;152;188 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. In addition to the increased number of whorls in the S23A cells, we also observed several patches where the epithelial layer invades into the stromal collagen plug. 2021 mBio Result HPV S23A 53 57 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. In support of this, E2-S23A was able to interact with E1 similarly to E2-WT. 2021 mBio Result HPV S23A 23 27 E1;E2;E2 54;20;70 56;22;72 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Interestingly, HFK+HPV16-S23D-C is predominantly integrated, and the additional band on the Southern blot. 2021 mBio Result HPV S23D 25 29 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. It is also clear that there are other factors that can regulate the interaction of E2 with chromatin, as E2-S23A still interacts with mitotic chromatin, and TopBP1 is also recruited to mitotic chromatin with E2-S23A. 2021 mBio Result HPV S23A;S23A 108;211 112;215 E2;E2;E2 83;105;208 85;107;210 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Keratin 10 staining started "higher" in the epithelium in the S23A cells, while there are large patches of the S23A samples where there is an absence of involucrin staining reaching the upper layers of the epithelium. 2021 mBio Result HPV S23A;S23A 62;111 66;115 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Koilocytes are indicative of a more transformed cell, and in addition to these cells, we also observed a significant increase in whorls with the S23A mutant cells. 2021 mBio Result HPV S23A 145 149 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Lane 1 demonstrates an interaction between E2-S23D and GST-TopBP1, while lane 2 demonstrates that E2-WT does not interact with TopBP1. 2021 mBio Result HPV S23D 46 50 E2;E2 43;98 45;100 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Lanes 5 and 6 in聽Fig.聽2A聽demonstrate equivalent levels of E2-S23D and E2-WT input in the GST interactions. 2021 mBio Result HPV S23D 61 65 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. On the first attempt at immortalization, two out of three donors transfected with HPV16-WT and HPV16-S23D generated successful, immortalized cell lines, whereas none of the donors were successfully immortalized by the HPV16-S23A variant (not shown). 2021 mBio Result HPV S23D;S23A 101;224 105;228 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. One potential host protein mediating this function is BRD4, and we demonstrate that BRD4 is able to interact with E2-S23A and that TopBP1 and BRD4 exist in the same cellular complex. 2021 mBio Result HPV S23A 117 121 E2 114 116 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Strikingly, the pattern of staining for both differentiation markers is different in the S23A cells compared with wild-type cells. 2021 mBio Result HPV S23A 89 93 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Strikingly, there are many more cyclin E-positive cells in the upper layers of the S23A raft compared with the wild-type counterpart and more cyclin E positivity overall. 2021 mBio Result HPV S23A 83 87 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Strikingly, there was a significant increase in E2 and TopBP1 levels 8 h following release in the E2-WT cells, but no increase of either E2 or TopBP1 in E2-S23A or Vec control cells. 2021 mBio Result HPV S23A 156 160 E2;E2;E2;E2 48;98;137;153 50;100;139;155 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The E2 S23A mutation disrupts E2 interaction with mitotic chromatin. 2021 mBio Result HPV S23A 7 11 E2;E2 4;30 6;32 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The increased koilocytes, whorls, and invasive nature of the S23A cells prompted us to next investigate the differentiation status of the wild-type and S23A organotypic rafts. 2021 mBio Result HPV S23A;S23A 61;152 65;156 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The less intense staining of mitotic chromatin with E2-S23A, compared with E2-WT, suggests that the interaction between E2 and TopBP1 may elevate E2 protein levels during mitosis. 2021 mBio Result HPV S23A 55 59 E2;E2;E2;E2 52;75;120;146 54;77;122;148 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The mutant E2-S23A localized to mitotic chromatin along with TopBP1, but the observed staining was less intense. 2021 mBio Result HPV S23A 14 18 E2 11 13 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The results therefore suggested that there was a failure of viral replication in the S23A cells, and to further investigate this, we carried out FISH staining with labeled HPV16 genome to determine the levels of viral DNA in the rafts. 2021 mBio Result HPV S23A 85 89 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Their growth rate was no different from HFK+HPV16-WT or HFK+HPV16-S23D. 2021 mBio Result HPV S23D 66 70 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. There is clearly a "thinner" epithelium with the HPV16 S23A genome containing cells. 2021 mBio Result HPV S23A 55 59 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. There is more viral DNA in the S23A cells when they are grown on plastic. 2021 mBio Result HPV S23A 31 35 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Therefore, there may be some residual E2 expression in the S23A sample, but it is dramatically reduced. 2021 mBio Result HPV S23A 59 63 E2 38 40 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. This was quantitated in two independent rafts from two independent donors, and statistically significantly different levels of cyclin E2 were observed in the S23A cells. 2021 mBio Result HPV S23A 158 162 E2 134 136 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. To investigate the interaction between E2 and TopBP1 via serine 23, U2OS cells stably expressing E2-WT (wild-type), E2-S23A (serine mutated to alanine), and E2-S23D (serine mutated to aspartic acid) were generated, along with pcDNA empty vector plasmid control. 2021 mBio Result HPV S23A;S23D 119;160 123;164 E2;E2;E2;E2 39;97;116;157 41;99;118;159 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. To investigate the role of serine 23 during the HPV16 life cycle, we generated HPV16 genomes containing the E2 S23A and S23D mutations (HPV16-WT, HPV16-S23A, and HPV16-S23D). 2021 mBio Result HPV S23A;S23D;S23A;S23D 111;120;152;168 115;124;156;172 E2 108 110 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. To investigate whether E2 is phosphorylated on serine 23 during mitosis, we prepared mitotically enriched U2OS E2-WT and E2-S23A cells. 2021 mBio Result HPV S23A 124 128 E2;E2;E2 23;111;121 25;113;123 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. TopBP1 pulled down both E2-WT and E2-S23D (as it does in U2OS cells [Fig. 2021 mBio Result HPV S23D 37 41 E2;E2 24;34 26;36 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Treatment with CX4945 disrupted the interaction between TopBP1 and E2-WT but had no effect on the interaction with TopBP1 interaction with E2-S23D. 2021 mBio Result HPV S23D 142 146 E2;E2 67;139 69;141 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Unfortunately, we were unable to produce recombinant E2 S23A protein, despite repeated tries and confirmation that appropriate RNA was being produced in the bacteria following induction. 2021 mBio Result HPV S23A 56 60 E2 53 55 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Upon seeding onto the collagen plugs, the cells divide several times before they are induced to differentiate, indicating that the S23A cells are not replicating viral DNA. 2021 mBio Result HPV S23A 131 135 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Using our transient E1-E2 DNA replication assay, we demonstrated that both E2-WT and E2-S23A were able to activate replication with no significant difference between them. 2021 mBio Result HPV S23A 88 92 E1;E2;E2;E2 20;23;75;85 22;25;77;87 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. We established N/Tert-1 (human foreskin keratinocytes immortalized by human telomerase reverse transcriptase [hTERT]) cells expressing E2-WT and E2-S23A, as described previously, along with pcDNA Vec control. 2021 mBio Result HPV S23A 148 152 E2;E2 135;145 137;147 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. we investigate the expression of E2 in the S23A and wild-type rafts (Fig.聽9E; this is representative of two independent donor lines). 2021 mBio Result HPV S23A 43 47 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. We measured the transcriptional activation potential of E2-WT and E2-S23A using our ptk6E2-luc system, a plasmid with six E2 sites located upstream from the herpes simplex virus 1 (HSV-1) thymidine kinase (tk) promoter driving expression of luciferase (luc). 2021 mBio Result HPV S23A 69 73 E2;E2;E2 56;66;122 58;68;124 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. We prepared recombinant GST-TopBP1 (full length), His-E2-WT, and His-E2-S23D (amino acids 1 to 200 for both E2 proteins) from bacteria. 2021 mBio Result HPV S23D 72 76 E2;E2;E2 54;69;108 56;71;110 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. What is clear from this experiment is that there is not a significant difference between HFK+HPV16-WT and HFK+HPV16-S23A/S23D with regards to the episomal status of the viral genomes. 2021 mBio Result HPV S23D;S23A 121;116 125;120 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. While E2-WT and E2-S23D coprecipitate with TopBP1 (Fig.聽2C, lanes 4 and 5), E2-S23A is significantly compromised in this interaction. 2021 mBio Result HPV S23A 79 83 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. While E2-WT and E2-S23D coprecipitate with TopBP1. 2021 mBio Result HPV S23D 19 23 E2;E2 6;16 8;18 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. With E2-S23A cells, staining with pS23-Ab generates no visible staining in interphase cells, and a very marginal signal in mitotic cells. 2021 mBio Result HPV S23A 8 12 E2 5 7 34696378 Phylogenomic Analysis of Human Papillomavirus Type 31 and Cervical Carcinogenesis: A Study of 2093 Viral Genomes. One SNP mapping to the E7 oncogene (H23Y) was associated with CIN3+ (OR = 1.60, 95% CI = 1.17-2.19); this SNP was most common in samples with A2 or B2 genomes (Table S7). 2021 Viruses Result HPV H23Y 36 40 E7 23 25 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Additionally, 4 variants had significantly higher frequencies among non-malignant specimens [E1 (G1363A; G167S), L2 (A5063C; N276T), L2 (A5492C; I418T), and L1 (A6434G; T266A)]. 2022 Translational oncology Result HPV G1363A;G167S;A5063C;N276T;A5492C;I418T;A6434G;T266A 97;105;117;125;137;145;161;169 103;110;123;130;143;150;167;174 E1;L1;L2;L2 93;157;113;133 95;159;115;135 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. All such deleterious variants were rare (frequency < 0.05), except for the E2/E4 variant A3366C. 2022 Translational oncology Result HPV A3366C 89 95 E2;E4 75;78 77;80 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Among the lineages and sublineages of HPV16 thus identified, additionally a total of 35 bi-allelic variants were found capable of distinguishing lineages A and D, while 6 could distinguish between D1 and D2 sublineages (T732C, T2343C, C3161T, A4599C, A6180C, A6316G) (Table S2). 2022 Translational oncology Result HPV T732C;T2343C;C3161T;A4599C;A6180C;A6316G 220;227;235;243;251;259 225;233;241;249;257;265 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Based on earlier reports, E2 (T3694A), E6 (A532G) and LCR (T7743G, G7834T) variants were used to identify lineages and sublineages. 2022 Translational oncology Result HPV T3694A;A532G;T7743G;G7834T 30;43;59;67 36;48;65;73 LCR;E2;E6 54;26;39 57;28;41 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Five variants were found only among the non-malignant specimens namely, E7 (C790T:R77C), E2 (C3236G:H161D), E2/E4 (A3605G:284D), LCR (A7550G) and NCR-2 (T4222C), portraying significant p-values after multiple testing correction. 2022 Translational oncology Result HPV C790T;R77C;C3236G;H161D;A3605G;A7550G;T4222C 76;82;93;100;115;134;153 81;86;99;105;121;140;159 LCR;E2;E2;E4;E7 129;89;108;111;72 132;91;110;113;74 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. The co-existence of LCR:C7577T, E5:A3979C, A4042G and E6:T350G variants were found in 10 A1 haplotypes or nodes (E-16, E-18, E-19, E-22, E-26, E-28, E-37, E-38, E-41 and E-42), majority of which were case specific or overrepresented among case samples and across all D haplotypes that represented cases only, except for specimen number T173, which lacked the T350G variant. 2022 Translational oncology Result HPV C7577T;A3979C;A4042G;T350G;T350G 24;35;43;57;359 30;41;49;62;364 LCR;E5;E6 20;32;54 23;34;56 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Those, proportionately higher among tumor specimens were E5 (A3979C:Y44L, A4042G:I65V), E6 (T350G:L83V), and LCR (C7577T) with a combined odds ratio (95% CI) of 20.5 (4.61-91.25). 2022 Translational oncology Result HPV A3979C;Y44L;A4042G;I65V;T350G;L83V;C7577T 61;68;74;81;92;98;114 67;72;80;85;97;102;120 LCR;E5;E6 109;57;88 112;59;90 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. Calculated by Codeml software using Naive NEB and Bayes Empirical Bayes models, seven positive selection sites of alpha-9 HPV E6 were detected, there were D32E of HPV-16 E6, K35N, K93N, R145I of HPV-33 E6, K93R of HPV-52 E6, K93N, R145K of HPV-58 E6. 2022 Virology journal Result HPV D32E;K35N;K93N;R145I;K93R;K93N;R145K 155;174;180;186;206;225;231 159;178;184;191;210;229;236 E6;E6;E6;E6;E6 126;170;202;221;247 128;172;204;223;249 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. D86E, K93N changed epitopes number and affinity, and R145K changed HLA-I epitope. 2022 Virology journal Result HPV D86E;K93N;R145K 0;6;53 4;10;58 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. E21K, L46V, E89K, K93R and N127I changed epitopes number and affinity; 105 M increased epitope affinity; N122K decreased epitopes number and E138K decreased epitope affinity. 2022 Virology journal Result HPV E21K;E138K;L46V;E89K;K93R;N127I;N122K 0;141;6;12;18;27;105 4;146;10;16;22;32;110 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. E32Q, D86E, K93N and R145K are located in the coil of HPV-58 E6 protein, E32Q, K93N situated on the outer edge of E6 protein, and close to the zinc granule, belonging to the active region of E6 protein. 2022 Virology journal Result HPV E32Q;D86E;K93N;R145K;E32Q;K93N 0;6;12;21;73;79 4;10;16;26;77;83 E6;E6;E6 61;114;191 63;116;193 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. H60Y, K65R changed epitope number and affinity, T64A decreased epitope number, and K123R, A138V made new epitope appear. 2022 Virology journal Result HPV H60Y;K65R;T64A;K123R;A138V 0;6;48;83;90 4;10;52;88;95 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. In HPV-16 E6, I34R, L35V, R62I, P66A and L90V all located in beta-fold, E120D, D32N, D32E located in the periphery of the spatial protein structure and close to the active region of znic granules. 2022 Virology journal Result HPV E120D;D32N;D32E;I34R;L35V;R62I;P66A;L90V 72;79;85;14;20;26;32;41 77;83;89;18;24;30;36;45 E6 10 12 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. In HPV-31 E6, T64A, K65R, and F69L located in alpha-helix, T60Y located in beta-sheet region, and K123R, A138V located in the coil. 2022 Virology journal Result HPV T64A;K65R;F69L;T60Y;K123R;A138V 14;20;30;59;98;105 18;24;34;63;103;110 E6 10 12 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K35N decreased epitope number and affinity; S74T, N86H, K93N and R145I changed epitope number and affinity; Q113R increased epitope affinity. 2022 Virology journal Result HPV K35N;S74T;N86H;K93N;R145I;Q113R 0;44;50;56;65;108 4;48;54;60;70;113 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. M1K made epitope affinity increase; R17G, D32N, D32E, I34R, L35V, P66A, H85Y and L90V changed epitope number and affinity; E120D and R151T made new epitopes appear. 2022 Virology journal Result HPV M1K;D32N;D32E;E120D;R17G;I34R;L35V;P66A;H85Y;L90V;R151T 0;42;48;123;36;54;60;66;72;81;133 3;46;52;128;40;58;64;70;76;85;138 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R77K, E89K of HPV-52 E6 located in alpha-helix, N127I located in the beta-sheet region, K93R situated on the outer edge of E6 protein and close to the zinc granules, all the amino acid substitutions found in the active region of the protein. 2022 Virology journal Result HPV R77K;E89K;N127I;K93R 0;6;48;88 4;10;53;92 E6;E6 21;123 23;125 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. S74T and Q113R located in alpha-helix of HPV-33 E6 protein, K93N located on the outer edge of E6 protein and near the zinc granule, the above amino acid substitutions all located in the active region of the protein. 2022 Virology journal Result HPV S74T;Q113R;K93N 0;9;60 4;14;64 E6;E6 48;94 50;96 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. Six (6) new variants were identified based on the sequencing of the L1 region, HPV-16 (L441P, S343P), HPV-18 (S424P), HPV-45 (Q366H, Y365F), belonging to the HPV HR-HPV group and HPV-84 (F458L) belonging to the LR-HPV group. 2022 BMC infectious diseases Result HPV Q366H;L441P;S343P;S424P;Y365F;F458L 126;87;94;110;133;187 131;92;99;115;138;192 L1 68 70 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Because the change of one amino acid from N to S abolishes H-2Db-restricted presentation of E7 CTL epitope aa 49 to 57, we vaccinated HLA-A2 (AAD) mice using CRT/E7(N53S) DNA vaccine followed by EP. 2022 mBio Result HPV N53S 165 169 E7;E7 92;162 94;164 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. H-2Db-expressing 293 cells transfected with CRT/E7 but not CRT/E7(N53S) DNA were able to significantly activate the H-2Db-restricted HPV16 E7 peptide (aa 49 to 57)-specific CD8+ T cells. 2022 mBio Result HPV N53S 66 70 E7;E7;E7 48;63;139 50;65;141 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Here, we further confirmed that the mutated E7(N53S) prevents murine MHC-I (H-2Db) presentation. 2022 mBio Result HPV N53S 47 51 E7 44 46 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. HPV16 E6(R55K)(delK75) mutations eliminate murine MHC-I-restricted E6-specific CD8+ T cell-mediated immune response in C57BL/6 mice. 2022 mBio Result HPV R55K 9 13 E6;E6 6;67 8;69 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. In order to eliminate the presentation of E6 protein through the H-2Kb molecule, we generate a mutated HPV16 E6, E6(R55K). 2022 mBio Result HPV R55K 116 120 E6;E6;E6 42;109;113 44;111;115 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. In order to test this, we vaccinated HLA-A2 (AAD) mice with pcDNA3-CRT/E6(R55K)(delK75) DNA followed by EP twice at 1-week intervals. 2022 mBio Result HPV R55K 74 78 E6 71 73 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Injection of DNA plasmids encoding LucE6(R55K)(delK75)/E7(R53S), NRasG12V, and SB100 followed by EP results in development of sarcoma in the oral/pharyngeal cavity in HLA-A2 (AAD) transgenic mice. 2022 mBio Result HPV R55K;R53S 41;58 45;62 E7 55 57 Sarcoma 126 133 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Injection of DNA plasmids encoding LucE7(N53S)E6(R55K)(delK75), AKT, c-Myc, and SB100 followed by EP results in development of squamous cell carcinoma in the oral/pharyngeal cavity in HLA-A2 (AAD) transgenic mice. 2022 mBio Result HPV N53S;R55K 41;49 45;53 E6 46 48 Squamous cell carcinoma 127 150 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Mice vaccinated with CRT/E6(R55K) DNA vaccine followed by EP failed to mount E6-specific CD8+ T cell-mediated immune responses against E6.10 peptide but created new strong CD8+ T cell-mediated immune responses against HPV16 E6.14 and E6.15 peptides. 2022 mBio Result HPV R55K 28 32 E6;E6;E6;E6;E6 25;77;135;224;234 27;79;137;226;236 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Mice vaccinated with CRT/E6(R55K)(delK75) DNA vaccine followed by EP were unable to mount any HPV16 E6-specific CD8+ T cell-mediated immune responses in vaccinated C57BL/6 mice. 2022 mBio Result HPV R55K 28 32 E6;E6 25;100 27;102 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Mutated HPV16 E7(N53S) reveals presentation of human MHC-I-restricted E7 peptide (aa 11 to 20)-specific CTL epitope through human HLA-A2 molecule in E7 DNA-transfected cells. 2022 mBio Result HPV N53S 17 21 E7;E7;E7 14;70;149 16;72;151 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Taken together, our data indicated that HLA-A2 (AAD) transgenic mice vaccinated with DNA vaccine encoding CRT linked to E6(R55K)(delK75) and boosted with TA-HPV generated only HLA-A2-restricted (but not murine MHC-I-restricted) E6-specific CD8+ T cell-mediated immune responses, even though TA-HPV expresses wild-type HPV16 E6. 2022 mBio Result HPV R55K 123 127 E6;E6;E6 120;228;324 122;230;326 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Then, DNA plasmids encoding LucE6(R55K)(delK75)/E7(R53S), NRasG12V, and SB100 were injected into the submucosa of the oral/pharyngeal cavity of mice followed by EP. 2022 mBio Result HPV R55K;R53S 34;51 38;55 E7 48 50 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Then, DNA plasmids encoding LucE7(N53S)E6(R55K)(delK75), AKT, c-Myc, and SB100 were injected into the submucosa of the oral/pharyngeal cavity of mice, followed by EP. 2022 mBio Result HPV N53S;R55K 34;42 38;46 E6 39 41 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. These cell lines were further transfected with CRT/E7 or CRT/E7(N53S) DNA constructs. 2022 mBio Result HPV N53S 64 68 E7;E7 51;61 53;63 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. These data indicated transfection of cells with DNA encoding CRT linked to E7(N53S) abolishes the presentation of E7 through the murine MHC-I (H-2Db) molecule, leading to the presentation of E7 through the human MHC-I (HLA-A2) molecule. 2022 mBio Result HPV N53S 78 82 E7;E7;E7 75;114;191 77;116;193 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. These data suggest that vaccination with DNA encoding CRT linked to E6(R55K)(delK75) fails to elicit murine MHC-I-restricted E6-specific CD8+ T cell-mediated immune responses in the C57BL/6 mice. 2022 mBio Result HPV R55K 71 75 E6;E6 68;125 70;127 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Transfection of human HLA-A2 (AAD)-expressing 293 cells with CRT/E7(N53S) activated the HLA-A2-restricted HPV16 E7 peptide (aa 11 to 20)-specific CD8+ T cell line, but the CRT/E7 construct did not. 2022 mBio Result HPV N53S 68 72 E7;E7;E7 65;112;176 67;114;178 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Vaccination of HLA-A2 (AAD) transgenic mice with DNA encoding CRT linked to E6(R55K)(delK75) followed by boost with TA-HPV vaccinia generates potent HLA-A2-restricted E6 peptide (aa 29 to 38)-specific CD8+ T cell-mediated immune responses. 2022 mBio Result HPV R55K 79 83 E6;E6 76;167 78;169 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. We then generated the double mutant E6(R55K)(delK75). 2022 mBio Result HPV R55K 39 43 E6 36 38 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. While mutant E6(R55K)(delK75) and mutant E7(N53S) were not presented through murine MHC-I molecules, one concern for using these E6/E7 mutants for the creation of the spontaneous E6/E7-expressing cancer in the oral/pharyngeal cavity is the loss of their oncogenicity. 2022 mBio Result HPV R55K;N53S 16;44 20;48 E6;E6;E6;E7;E7;E7 13;129;179;41;132;182 15;131;181;43;134;184 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. Concerning E-A176/G350 (blue), the equilibrium was reached at the first 20 ns, but a greater disturbance episode it's observed from 100 ns to the end of the trajectory it is also thought that the nature of mutation D25N in the proteins may contribute to this behavior. 2022 Scientific reports Result HPV D25N 215 219 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. E6 mutations Q14H, D25N, I27R, E29Q and H78Y are found in a non-domain region adjacent to the zinc finger domain 1. 2022 Scientific reports Result HPV E29Q;Q14H;D25N;I27R;H78Y 31;13;19;25;40 35;17;23;29;44 E6 0 2 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. Mutations E29Q and D25N remained the same size; therefore, not visible change in 3D structure was observed. 2022 Scientific reports Result HPV E29Q;D25N 10;19 14;23 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. The mutation L83V found in all the variants can cause the proteins to lose interactions with other proteins because, V83 is a smaller residue than L83. 2022 Scientific reports Result HPV L83V 13 17 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. This behaviour is attributed to mutations in the E29A and L83V positions that directly affect the structure of the protein, causing disturbs in it's stability. 2022 Scientific reports Result HPV E29A;L83V 49;58 53;62 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. This phenomenon is interesting and it's attributed to mutation E29Q exclusive of the E-C188/G350 variant, while the behavior of the other variants is exclusive of their own structural changes caused by their shared and exclusive mutations. 2022 Scientific reports Result HPV E29Q 63 67 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. While E6 mutations L83V and H78Y are located in an interdomain region between the two zinc finger domains. 2022 Scientific reports Result HPV L83V;H78Y 19;28 23;32 E6 6 8 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. Also, in 100% of the samples, a T7595C mutation corresponded to the disappearance of binding sites of TFIID and TBP transcription factors. 2022 The Canadian journal of infectious diseases & medical microbiology Result HPV T7595C 32 38 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. Compared to the HPV 18 reference, except for STi119 isolate, C7486T led to the emergence of binding sites for c-Fos and MBF1 in 93.0% of the samples. 2022 The Canadian journal of infectious diseases & medical microbiology Result HPV C7486T 61 67 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. Seven SNPs were specific to the sequences of HPV 16, and two SNPs were newly detected in the studied HPV 18 samples (A7382T, T7384G, C7387T, C7393G, A7431G, T7448C, and C7783A in the HPV16 LCR and C7577A and A7943T in the HPV18 LCR). 2022 The Canadian journal of infectious diseases & medical microbiology Result HPV A7382T;T7384G;C7387T;C7393G;A7431G;T7448C;C7783A;C7577A;A7943T 117;125;133;141;149;157;169;197;208 123;131;139;147;155;163;175;203;214 LCR;LCR 189;228 192;231 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. The phylogenetic tree analysis revealed that among the 110 samples, 27 belonged to the HPV16 European type (Ep), 17 belonged to the Asian strain (As), 59 belonged to European variant (E), and 7 of European variants became an independent branch, related to the E6 T295G mutation. 2022 Cancer cell international Result HPV T295G 263 268 E6 260 262 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. All of the changes in HPV52 L1 gene were synonymous mutation except L5S (6.7%, 1/15). 2022 Virology journal Result HPV L5S 68 71 L1 28 30 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Another high frequent variation was A5316C (25.9%, 7/27), which changed asparagine into threonine (N181T). 2022 Virology journal Result HPV A5316C;N181T 36;99 42;104 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. For E7 sequences, the high frequent mutations was C751T and A801G, both were synonymous mutations. 2022 Virology journal Result HPV C751T;A801G 50;60 55;65 E7 4 6 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Seven synonymous mutations in HPV52 L1 gene, including G6110A, T6701G, T6764C, A6794G and C6824T were found in 93.3% (14/15) samples. 2022 Virology journal Result HPV G6110A;T6701G;T6764C;A6794G;C6824T 55;63;71;79;90 61;69;77;85;96 L1 36 38 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Specially, four changes were non-synonymous mutations, including: H76Q (1/27), N181T (7/27), E240D (1/27) and T266A (27/27). 2022 Virology journal Result HPV E240D;H76Q;N181T;T266A 93;66;79;110 98;70;84;115 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The A5570G gene variation was found in all of 27 samples and brought the amino acid change from threonine to alanine (T266A). 2022 Virology journal Result HPV A5570G;T266A 4;118 10;123 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The G6218A was detected in all of fifteen sequences. 2022 Virology journal Result HPV G6218A 4 10 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The most common synonymous mutations in L1 gene were A5803C (66.7%, 18/27) and G6196A (70.4%, 19/27). 2022 Virology journal Result HPV A5803C;G6196A 53;79 59;85 L1 40 42 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The most frequently non-synonymous mutation in HPV E6 genes were T7220G (A) (5/18), which made D32E mutation. 2022 Virology journal Result HPV T7220G;D32E 65;95 71;99 E6 51 53 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The most frequently observed non-synonymous in HPV16 E7 genes were C7791T (S63F) (Table 5). 2022 Virology journal Result HPV C7791T;S63F 67;75 73;79 E7 53 55 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The most prevalent non-synonymous mutations in E6 genes was A379G (14/15) and cause the amino acid to change from Lysine to arginine (K93R). 2022 Virology journal Result HPV K93R;A379G 134;60 138;65 E6 47 49 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The most frequent of the novel changes, found in 19 E subtype sequences, is the synonymous A334G which appears to identify an HPV16 variant characteristic of the region. 2009 Infectious agents and cancer Conclusion HPV A334G 91 96 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Three variants of the E subtype were identified: E-P (n = 27, 71.1%), E-T350G (n = 7, 18.4%), E-C188G (n = 2, 5.3%). 2009 Infectious agents and cancer Conclusion HPV T350G;C188G 72;96 77;101 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In summary, the finding of this study is that the R10G/L83V variations in E6 and C7294T co-variation in LCR was significantly associated with risk for developing >=CIN2,3. 2013 BMC cancer Conclusion HPV R10G;L83V;C7294T 50;55;81 54;59;87 LCR;E6 104;74 107;76 Cervical intraepithelial neoplasia 164 168 24823962 Human papillomavirus type 16 long control region and E6 variants stratified by cervical disease stage. Overall, there appeared to be no individual LCR or E6 sites, or combinations thereof, including the T350G (L83V) E6 substitution, that demonstrated any significant association with cervical disease stage. 2014 Infection, genetics and evolution Conclusion HPV T350G;L83V 100;107 105;111 LCR;E6;E6 44;51;113 47;53;115 Cervical diseases 181 197 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. This study aimed at verifying the immunogenicity induced by a preventive vaccine expressing the HPV-16 E6F47R protein and the therapeutic efficacy of different immunization protocols after challenging mice with TC-1* cells. 2015 Journal of translational medicine Conclusion HPV F47R 105 109 E6 103 105 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7193T and G7521A detected in all the infections, were predicted to locate at the binding site for FOXA1 and SOX9, respectively. 2017 PloS one Conclusion HPV G7193T;G7521A 0;11 6;17 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. In addition, A7730C variant, which showed a high mutation frequency in cervical cancer, was predicted to be a binding site for the cellular transcription factor PHOX2A. 2017 PloS one Conclusion HPV A7730C 13 19 Cervical carcinoma 71 86 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. The study highlights the presence of T390P mutation, located in the H-I loop and could interact with vaccines induced monoclonal antibodies suggesting a potential impact of this mutation on the efficacy of available anti-HPV vaccines. 2017 Bioinformation Conclusion HPV T390P 37 42 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. In the present study, it was possible to observe 12 HPV6B3 variants, all of which presented the G474A mutation. 2019 Advances in virology Conclusion HPV G474A 96 101 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. One HPV6B3 sample also showed the T369G mutation. 2019 Advances in virology Conclusion HPV T369G 34 39 31186642 Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil. T410C alteration was found in one of the HPV11 samples. 2019 Advances in virology Conclusion HPV T410C 0 5 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. Interestingly, the N29S mutation confered greater 3D structure stability compared to those of the H51N variant and the E7 reference; this outcome may be related to the fact that N29S is an additional phosphorylation site. 2021 International journal of molecular sciences Conclusion HPV H51N;N29S;N29S 98;19;178 102;23;182 E7 119 121 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. Our findings show, for the first time, that an amino acid change in a variant (N29S and H51N) affected the 3D structure of the E7 protein. 2021 International journal of molecular sciences Conclusion HPV H51N;N29S 88;79 92;83 E7 127 129 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The H51N variant showed a lower 3D structure stability than the other systems. 2021 International journal of molecular sciences Conclusion HPV H51N 4 8 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The mutation of asparagine 29 to serine in the N29S variant was reported to confer an additional phosphorylation site at S29 due to its proximity to the CKII recognition motif, which phosphorylates S31 and S32. 2021 International journal of molecular sciences Conclusion HPV N29S;N29S 47;16 51;39 33573298 Modeling and Molecular Dynamics of the 3D Structure of the HPV16 E7 Protein and Its Variants. The stability we observed in the MD simulation trajectories of N29S could be induced by this additional phosphorylation, which affected the global structure of the protein. 2021 International journal of molecular sciences Conclusion HPV N29S 63 67 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. Through the analysis of 11,088 HBV genomes and 1637 HPV-16 genomes, some valuable mutations, including the T350G of HBV and the C659T of HPV-16, were detected. 2021 Computational and structural biotechnology journal Conclusion HPV T350G 107 112 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. alpha-9 HPV E6 positive selection sites that adaptive to the environment D32E, K35N, K93N, R145I, K93R, R145K have been widely spread, they all located in the E6 protein active region and altered their protein structure, as well as overall reduce the immunogenicity of the E6 protein, so that HPV infected cells are more difficult to be detected by the immune system and enhance the adaptability of alpha-9 HPV to the environment. 2022 Virology journal Conclusion HPV D32E;K35N;K93N;R145I;K93R;R145K 73;79;85;91;98;104 77;83;89;96;102;109 E6;E6;E6 12;159;273 14;161;275 HPV infections 293 305 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. N86H, R145I (positive selection site) of HPV-33 E6 and D86E, R145K (positive selection site) of HPV-58 E6 occurred in the same location of E6. 2022 Virology journal Conclusion HPV N86H;R145I;D86E;R145K 0;6;55;61 4;11;59;66 E6;E6;E6 48;103;139 50;105;141 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. The positive selection site K93N of HPV-33 E6, K93R of HPV-52 E6 and K93N of HPV-58 E6 all occurred in the 93rd amino acid of E6 protein. 2022 Virology journal Conclusion HPV K93N;K93R;K93N 28;47;69 32;51;73 E6;E6;E6;E6 43;62;84;126 45;64;86;128 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A182T 2009 Infectious agents and cancer Table HPV A182T 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A330G 2009 Infectious agents and cancer Table HPV A330G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A334G 2009 Infectious agents and cancer Table HPV A334G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A354G 2009 Infectious agents and cancer Table HPV A354G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A361G 2009 Infectious agents and cancer Table HPV A361G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A404T 2009 Infectious agents and cancer Table HPV A404T 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A91C 2009 Infectious agents and cancer Table HPV A91C 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. A97G 2009 Infectious agents and cancer Table HPV A97G 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. C173A 2009 Infectious agents and cancer Table HPV C173A 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. C188G 2009 Infectious agents and cancer Table HPV C188G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. C206T 2009 Infectious agents and cancer Table HPV C206T 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. C360G 2009 Infectious agents and cancer Table HPV C360G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. C374A 2009 Infectious agents and cancer Table HPV C374A 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. G188C 2009 Infectious agents and cancer Table HPV G188C 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. H24N 2009 Infectious agents and cancer Table HPV H24N 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. I101F 2009 Infectious agents and cancer Table HPV I101F 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. I27L 2009 Infectious agents and cancer Table HPV I27L 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. L83E 2009 Infectious agents and cancer Table HPV L83E 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Q35stop 2009 Infectious agents and cancer Table HPV Q35X 0 7 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Q91K 2009 Infectious agents and cancer Table HPV Q91K 0 4 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. T331A 2009 Infectious agents and cancer Table HPV T331A 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. T350G 2009 Infectious agents and cancer Table HPV T350G 0 5 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. T351A 2009 Infectious agents and cancer Table HPV T351A 0 5 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. L83V 2012 PloS one Table HPV L83V 0 4 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. D25E 2012 PloS one Table HPV D25E 0 4 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. L83V 2012 PloS one Table HPV L83V 0 4 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. N29S 2012 PloS one Table HPV N29S 0 4 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. 1374ins 2012 PloS one Table HPV 1374ins 0 7 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. C14A 2013 PloS one Table HPV C14A 0 4 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. D493N 2013 PloS one Table HPV D493N 0 5 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. L648C 2013 PloS one Table HPV L648C 0 5 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. N92S 2013 PloS one Table HPV N92S 0 4 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. P344R 2013 PloS one Table HPV P344R 0 5 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. P399R 2013 PloS one Table HPV P399R 0 5 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. P91R 2013 PloS one Table HPV P91R 0 4 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. R25Q 2013 PloS one Table HPV R25Q 0 4 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. R649V 2013 PloS one Table HPV R649V 0 5 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. V15L 2013 PloS one Table HPV V15L 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. A131G 2013 BMC infectious diseases Table HPV A131G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. A289G 2013 BMC infectious diseases Table HPV A289G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. A403G 2013 BMC infectious diseases Table HPV A403G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. A442C 2013 BMC infectious diseases Table HPV A442C 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. A61G 2013 BMC infectious diseases Table HPV A61G 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. C143G 2013 BMC infectious diseases Table HPV C143G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. C285G 2013 BMC infectious diseases Table HPV C285G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. C335T 2013 BMC infectious diseases Table HPV C335T 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. D64E 2013 BMC infectious diseases Table HPV D64E 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. E350G 2013 BMC infectious diseases Table HPV E350G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. G132T 2013 BMC infectious diseases Table HPV G132T 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. G145T 2013 BMC infectious diseases Table HPV G145T 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. H78Y 2013 BMC infectious diseases Table HPV H78Y 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. L83V 2013 BMC infectious diseases Table HPV L83V 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Q14D 2013 BMC infectious diseases Table HPV Q14D 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Q14H 2013 BMC infectious diseases Table HPV Q14H 0 4 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. T109C 2013 BMC infectious diseases Table HPV T109C 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. T286A 2013 BMC infectious diseases Table HPV T286A 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. T295G 2013 BMC infectious diseases Table HPV T295G 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. T325C 2013 BMC infectious diseases Table HPV T325C 0 5 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. T350G 2013 BMC infectious diseases Table HPV T350G 0 5 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7238C 2013 BMC cancer Table HPV A7238C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7279T 2013 BMC cancer Table HPV A7279T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7287C 2013 BMC cancer Table HPV A7287C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7289C 2013 BMC cancer Table HPV A7289C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7326G 2013 BMC cancer Table HPV A7326G 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7339T 2013 BMC cancer Table HPV A7339T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7515C 2013 BMC cancer Table HPV A7515C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7602G 2013 BMC cancer Table HPV A7602G 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7730C 2013 BMC cancer Table HPV A7730C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7740T 2013 BMC cancer Table HPV A7740T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. A7884C 2013 BMC cancer Table HPV A7884C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. C7270T 2013 BMC cancer Table HPV C7270T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. C7294T 2013 BMC cancer Table HPV C7294T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. C7436T 2013 BMC cancer Table HPV C7436T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. C7930T 2013 BMC cancer Table HPV C7930T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. D25E 2013 BMC cancer Table HPV D25E 0 4 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7319A 2013 BMC cancer Table HPV G7319A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7447T 2013 BMC cancer Table HPV G7447T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7456A 2013 BMC cancer Table HPV G7456A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7502T 2013 BMC cancer Table HPV G7502T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7521A 2013 BMC cancer Table HPV G7521A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7553T 2013 BMC cancer Table HPV G7553T 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7677A 2013 BMC cancer Table HPV G7677A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7683A 2013 BMC cancer Table HPV G7683A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7842A 2013 BMC cancer Table HPV G7842A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7868A 2013 BMC cancer Table HPV G7868A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. G7885A 2013 BMC cancer Table HPV G7885A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. H78Y 2013 BMC cancer Table HPV H78Y 0 4 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. L83V 2013 BMC cancer Table HPV L83V 0 4 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T350G 2013 BMC cancer Table HPV T350G 0 5 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7201C 2013 BMC cancer Table HPV T7201C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7228A 2013 BMC cancer Table HPV T7228A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7238A 2013 BMC cancer Table HPV T7238A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7350A 2013 BMC cancer Table HPV T7350A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7368G 2013 BMC cancer Table HPV T7368G 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7503G 2013 BMC cancer Table HPV T7503G 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7608C 2013 BMC cancer Table HPV T7608C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7714G 2013 BMC cancer Table HPV T7714G 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7755A 2013 BMC cancer Table HPV T7755A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7781C 2013 BMC cancer Table HPV T7781C 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7841A 2013 BMC cancer Table HPV T7841A 0 6 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. T7880C 2013 BMC cancer Table HPV T7880C 0 6 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C161S 2014 PloS one Table HPV C161S 0 5 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C229S 2014 PloS one Table HPV C229S 0 5 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C379S 2014 PloS one Table HPV C379S 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S207A 2014 PloS one Table HPV S207A 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S243A 2014 PloS one Table HPV S243A 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S243D 2014 PloS one Table HPV S243D 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S243E 2014 PloS one Table HPV S243E 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S243N 2014 PloS one Table HPV S243N 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. S243Q 2014 PloS one Table HPV S243Q 0 5 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. D25N 2015 Virology journal Table HPV D25N 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. E29G 2015 Virology journal Table HPV E29G 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. F69L 2015 Virology journal Table HPV F69L 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. H78Y 2015 Virology journal Table HPV H78Y 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. I27L 2015 Virology journal Table HPV I27L 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. I27R 2015 Virology journal Table HPV I27R 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. I27T 2015 Virology journal Table HPV I27T 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. I52L 2015 Virology journal Table HPV I52L 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. K68T 2015 Virology journal Table HPV K68T 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. L28V 2015 Virology journal Table HPV L28V 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. L83V 2015 Virology journal Table HPV L83V 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Q14D 2015 Virology journal Table HPV Q14D 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Q14H 2015 Virology journal Table HPV Q14H 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. C51F 2015 Infectious agents and cancer Table HPV C51F 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. D64E 2015 Infectious agents and cancer Table HPV D64E 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. H78Y 2015 Infectious agents and cancer Table HPV H78Y 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. L12I 2015 Infectious agents and cancer Table HPV L12I 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. L12S 2015 Infectious agents and cancer Table HPV L12S 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. N29S 2015 Infectious agents and cancer Table HPV N29S 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. P13G 2015 Infectious agents and cancer Table HPV P13G 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. Q14D 2015 Infectious agents and cancer Table HPV Q14D 0 4 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. Q14H 2015 Infectious agents and cancer Table HPV Q14H 0 4 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. T350G 2016 Cancer medicine Table HPV T350G 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. D124A 2017 Journal of virology Table HPV D124A 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. D173A 2017 Journal of virology Table HPV D173A 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. E118A 2017 Journal of virology Table HPV E118A 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. H130R 2017 Journal of virology Table HPV H130R 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. K177A 2017 Journal of virology Table HPV K177A 0 5 27795438 The Cellular DNA Helicase ChlR1 Regulates Chromatin and Nuclear Matrix Attachment of the Human Papillomavirus 16 E2 Protein and High-Copy-Number Viral Genome Establishment. Y131A 2017 Journal of virology Table HPV Y131A 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A379G 2016 PloS one Table HPV A379G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A530G 2016 PloS one Table HPV A530G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A5771G 2016 PloS one Table HPV A5771G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A5909G 2016 PloS one Table HPV A5909G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A6794G 2016 PloS one Table HPV A6794G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A706G 2016 PloS one Table HPV A706G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A7657C 2016 PloS one Table HPV A7657C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A7865G 2016 PloS one Table HPV A7865G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A7938G 2016 PloS one Table HPV A7938G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. A801G 2016 PloS one Table HPV A801G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C348G 2016 PloS one Table HPV C348G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C6443T 2016 PloS one Table HPV C6443T 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C662T 2016 PloS one Table HPV C662T 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C6824T 2016 PloS one Table HPV C6824T 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C6917A 2016 PloS one Table HPV C6917A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C7207A 2016 PloS one Table HPV C7207A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C733T 2016 PloS one Table HPV C733T 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. C751T 2016 PloS one Table HPV C751T 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G350T 2016 PloS one Table HPV G350T 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G5720A 2016 PloS one Table HPV G5720A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G6083A 2016 PloS one Table HPV G6083A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G6110A 2016 PloS one Table HPV G6110A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G6218A 2016 PloS one Table HPV G6218A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G6698A 2016 PloS one Table HPV G6698A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7052A 2016 PloS one Table HPV G7052A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G707A 2016 PloS one Table HPV G707A 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7112A 2016 PloS one Table HPV G7112A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7168C 2016 PloS one Table HPV G7168C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7371T 2016 PloS one Table HPV G7371T 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G742A 2016 PloS one Table HPV G742A 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7622A 2016 PloS one Table HPV G7622A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7712C 2016 PloS one Table HPV G7712C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. G7861A 2016 PloS one Table HPV G7861A 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T13C 2016 PloS one Table HPV T13C 0 4 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T5578C 2016 PloS one Table HPV T5578C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T573A 2016 PloS one Table HPV T573A 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T5972C 2016 PloS one Table HPV T5972C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T6710G 2016 PloS one Table HPV T6710G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T6764C 2016 PloS one Table HPV T6764C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T727G 2016 PloS one Table HPV T727G 0 5 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T7624G 2016 PloS one Table HPV T7624G 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T7659C 2016 PloS one Table HPV T7659C 0 6 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. T848G 2016 PloS one Table HPV T848G 0 5 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7168G 2017 PloS one Table HPV A7168G 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7174C 2017 PloS one Table HPV A7174C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7175C 2017 PloS one Table HPV A7175C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7507T 2017 PloS one Table HPV A7507T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7636C 2017 PloS one Table HPV A7636C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7660G 2017 PloS one Table HPV A7660G 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7729C 2017 PloS one Table HPV A7729C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7730C 2017 PloS one Table HPV A7730C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7830C 2017 PloS one Table HPV A7830C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. A7900C 2017 PloS one Table HPV A7900C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7270T 2017 PloS one Table HPV C7270T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7310T 2017 PloS one Table HPV C7310T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7394T 2017 PloS one Table HPV C7394T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7395T 2017 PloS one Table HPV C7395T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7505T 2017 PloS one Table HPV C7505T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. C7886G 2017 PloS one Table HPV C7886G 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7193T 2017 PloS one Table HPV G7193T 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7219C 2017 PloS one Table HPV G7219C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7521A 2017 PloS one Table HPV G7521A 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. G7826A 2017 PloS one Table HPV G7826A 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7176G 2017 PloS one Table HPV T7176G 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7177A 2017 PloS one Table HPV T7177A 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7177C 2017 PloS one Table HPV T7177C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7328C 2017 PloS one Table HPV T7328C 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7393A 2017 PloS one Table HPV T7393A 0 6 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. T7743G 2017 PloS one Table HPV T7743G 0 6 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. T20I 2017 Journal of virology Table HPV T20I 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. C66C 2018 Virology journal Table HPV C66C 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. G41R 2018 Virology journal Table HPV G41R 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. G63D 2018 Virology journal Table HPV G63D 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. G63S 2018 Virology journal Table HPV G63S 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. S71F 2018 Virology journal Table HPV S71F 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. T20I 2018 Virology journal Table HPV T20I 0 4 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. V77A 2018 Virology journal Table HPV V77A 0 4 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C 2019 Scientific reports Table HPV T7791C 0 6 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. A442C 2019 Cancer cell international Table HPV A442C 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. A645C 2019 Cancer cell international Table HPV A645C 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. A646C 2019 Cancer cell international Table HPV A646C 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. A647G 2019 Cancer cell international Table HPV A647G 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. C360A 2019 Cancer cell international Table HPV C360A 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. G666A 2019 Cancer cell international Table HPV G666A 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. L28F 2019 Cancer cell international Table HPV L28F 0 4 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. L83V 2019 Cancer cell international Table HPV L83V 0 4 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T350G 2019 Cancer cell international Table HPV T350G 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T7447C 2019 Cancer cell international Table HPV T7447C 0 6 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T760C 2019 Cancer cell international Table HPV T760C 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T7711G 2019 Cancer cell international Table HPV T7711G 0 6 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T846C 2019 Cancer cell international Table HPV T846C 0 5 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T86K 2019 Cancer cell international Table HPV T86K 0 4 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. A6562G 2020 Journal of clinical microbiology Table HPV A6562G 0 6 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. T6553C 2020 Journal of clinical microbiology Table HPV T6553C 0 6 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. D153Y 2020 Frontiers in microbiology Table HPV D153Y 0 5 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. L262V 2020 Frontiers in microbiology Table HPV L262V 0 5 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. L65F 2020 Frontiers in microbiology Table HPV L65F 0 4 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. M207I 2020 Frontiers in microbiology Table HPV M207I 0 5 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Q142K 2020 Frontiers in microbiology Table HPV Q142K 0 5 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. R302T 2020 Frontiers in microbiology Table HPV R302T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A134C 2021 BMC cancer Table HPV A134C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A152G 2021 BMC cancer Table HPV A152G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A296C 2021 BMC cancer Table HPV A296C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A442C 2021 BMC cancer Table HPV A442C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A646C 2021 BMC cancer Table HPV A646C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A647C 2021 BMC cancer Table HPV A647C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A647G 2021 BMC cancer Table HPV A647G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. A95G 2021 BMC cancer Table HPV A95G 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C110G 2021 BMC cancer Table HPV C110G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C118G 2021 BMC cancer Table HPV C118G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C168G 2021 BMC cancer Table HPV C168G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C335T 2021 BMC cancer Table HPV C335T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C712A 2021 BMC cancer Table HPV C712A 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. C790T 2021 BMC cancer Table HPV C790T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. D32E 2021 BMC cancer Table HPV D32E 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. E36Q 2021 BMC cancer Table HPV E36Q 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. F57L 2021 BMC cancer Table HPV F57L 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. F76L 2021 BMC cancer Table HPV F76L 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G145T 2021 BMC cancer Table HPV G145T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G188C 2021 BMC cancer Table HPV G188C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G663A 2021 BMC cancer Table HPV G663A 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G666A 2021 BMC cancer Table HPV G666A 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G791T 2021 BMC cancer Table HPV G791T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. G823T 2021 BMC cancer Table HPV G823T 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. H51N 2021 BMC cancer Table HPV H51N 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. H85Y 2021 BMC cancer Table HPV H85Y 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. K18Q 2021 BMC cancer Table HPV K18Q 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. K72Q 2021 BMC cancer Table HPV K72Q 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. L19V 2021 BMC cancer Table HPV L19V 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. L35V 2021 BMC cancer Table HPV L35V 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. L90V 2021 BMC cancer Table HPV L90V 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. N29F 2021 BMC cancer Table HPV N29F 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. N29S 2021 BMC cancer Table HPV N29S 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. N29T 2021 BMC cancer Table HPV N29T 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Q10E 2021 BMC cancer Table HPV Q10E 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Q21H 2021 BMC cancer Table HPV Q21H 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. R77C 2021 BMC cancer Table HPV R77C 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. R77L 2021 BMC cancer Table HPV R77L 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T105G 2021 BMC cancer Table HPV T105G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T137G 2021 BMC cancer Table HPV T137G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T178A 2021 BMC cancer Table HPV T178A 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T178G 2021 BMC cancer Table HPV T178G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T185G 2021 BMC cancer Table HPV T185G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T24A 2021 BMC cancer Table HPV T24A 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T29S 2021 BMC cancer Table HPV T29S 0 4 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T310C 2021 BMC cancer Table HPV T310C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T350G 2021 BMC cancer Table HPV T350G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T434G 2021 BMC cancer Table HPV T434G 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T730C 2021 BMC cancer Table HPV T730C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T843C 2021 BMC cancer Table HPV T843C 0 5 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T846C 2021 BMC cancer Table HPV T846C 0 5 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A2925G 2021 Computational and structural biotechnology journal Table HPV A2925G 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A3977C 2021 Computational and structural biotechnology journal Table HPV A3977C 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A4040G 2021 Computational and structural biotechnology journal Table HPV A4040G 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A4363T 2021 Computational and structural biotechnology journal Table HPV A4363T 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A5224C 2021 Computational and structural biotechnology journal Table HPV A5224C 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. A6432G 2021 Computational and structural biotechnology journal Table HPV A6432G 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. C3409T 2021 Computational and structural biotechnology journal Table HPV C3409T 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. C6240G 2021 Computational and structural biotechnology journal Table HPV C6240G 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. G4936A 2021 Computational and structural biotechnology journal Table HPV G4936A 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. G7191T 2021 Computational and structural biotechnology journal Table HPV G7191T 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. T350G 2021 Computational and structural biotechnology journal Table HPV T350G 0 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. T4226C 2021 Computational and structural biotechnology journal Table HPV T4226C 0 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. A138V 2022 Virology journal Table HPV A138V 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. D105H 2022 Virology journal Table HPV D105H 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. D86E 2022 Virology journal Table HPV D86E 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. E32Q 2022 Virology journal Table HPV E32Q 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. E89K 2022 Virology journal Table HPV E89K 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. F69L 2022 Virology journal Table HPV F69L 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. H60Y 2022 Virology journal Table HPV H60Y 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. H85Y 2022 Virology journal Table HPV H85Y 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. I105M 2022 Virology journal Table HPV I105M 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. I34R 2022 Virology journal Table HPV I34R 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K123R 2022 Virology journal Table HPV K123R 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K65R 2022 Virology journal Table HPV K65R 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K93N 2022 Virology journal Table HPV K93N 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K93R 2022 Virology journal Table HPV K93R 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. L35V 2022 Virology journal Table HPV L35V 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. L46V 2022 Virology journal Table HPV L46V 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. L90V 2022 Virology journal Table HPV L90V 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. N122K 2022 Virology journal Table HPV N122K 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. N127I 2022 Virology journal Table HPV N127I 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. N65S 2022 Virology journal Table HPV N65S 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. N86H 2022 Virology journal Table HPV N86H 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. P66A 2022 Virology journal Table HPV P66A 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. Q113R 2022 Virology journal Table HPV Q113R 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R145I 2022 Virology journal Table HPV R145I 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R145K 2022 Virology journal Table HPV R145K 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R151T 2022 Virology journal Table HPV R151T 0 5 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R17G 2022 Virology journal Table HPV R17G 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R62I 2022 Virology journal Table HPV R62I 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. R77K 2022 Virology journal Table HPV R77K 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. S74T 2022 Virology journal Table HPV S74T 0 4 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. T64A 2022 Virology journal Table HPV T64A 0 4 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. F458L 2022 BMC infectious diseases Table HPV F458L 0 5 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. L441P 2022 BMC infectious diseases Table HPV L441P 0 5 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. S343P 2022 BMC infectious diseases Table HPV S343P 0 5 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. S424P 2022 BMC infectious diseases Table HPV S424P 0 5 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. Y365F 2022 BMC infectious diseases Table HPV Y365F 0 5 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). (C) Fluorescent images showing the localization of wildtype (an upper panel) and K292R mutant (a lower panel) EGFP-16E2 proteins in HeLa cells. 2008 Virology Figure HPV K292R 81 86 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). HeLa cells were transfected with either EGFP-16E2WT or EGFP-16E2K292R, and the E2 proteins were visualized by fluorescent microscopy at 48 h post-transfection. 2008 Virology Figure HPV K292R 64 69 E2 79 81 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). In each lane, HeLa cells were also transfected with an additional 1 mug of either pcDNA (lane 1), pEGFP, pEGFP-SENP1, or pEGFP-SENP1m (C599A) as indicated. 2008 Virology Figure HPV C599A 135 140 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. (B) E6-2 amplification by nested PCR with the E6F/PU-2R16 primer pair from direct PCR mixtures. 2009 Infectious agents and cancer Figure HPV E6F 46 49 E6 4 6 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Note that sequences with the A334G and A404T single nucleotide changes (framed) identified for the first time in this work, as well as the already known C188G, T350G variants are close to the E-P Ref (P) prototype variant. 2009 Infectious agents and cancer Figure HPV A334G;A404T;C188G;T350G 29;39;153;160 34;44;158;165 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The middle part describes the E6-1 amplicon of 650 bp generated by direct PCR with the LCRS/E7AS primer pair and the E6-2 amplicon of 626 bp generated by nested PCR with the E6F/PU-2R 16 primer pair. 2009 Infectious agents and cancer Figure HPV E6F 174 177 LCR;E6;E6 87;30;117 90;32;119 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. Within the E subtype the predominant variant was E-P (n = 27), followed by variants E-T350G (n = 7) and E-C188G (n = 2). 2009 Infectious agents and cancer Figure HPV T350G;C188G 86;106 91;111 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. RT-PCR detected three bands representing mRNAs of the full length and the splice variants E6I and E6II (A). 2011 Molecular cancer Figure HPV E6I 90 93 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. With the E6 antibody used (clone 6F4) and input of 120 mug of total protein, a band of the expected size was detected in extracts of NIKS transduced with all E6 proteins except R8Q. 2011 Molecular cancer Figure HPV R8Q 177 180 E6;E6 9;158 11;160 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. A cluster-based representation of altered genes in E6 wild-type or E6 D25E expressed C33A with intensity provided for each cell line, normalized to the control (C33A cells not expressing E6). 2011 Virology journal Figure HPV D25E 70 74 E6;E6;E6 51;67;187 53;69;189 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. A venn diagram showing the numbers of genes regulated by wild-type E6 or E6 D25E. 2011 Virology journal Figure HPV D25E 76 80 E6;E6 67;73 69;75 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Hierarchical cluster analysis of the wild-type E6 or E6 D25E viral oncogene expression microarrays. 2011 Virology journal Figure HPV D25E 56 60 E6;E6 47;53 49;55 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Protein expression analysis of wild-type E6 or E6 D25E using confocal microscopy. 2011 Virology journal Figure HPV D25E 50 54 E6;E6 41;47 43;49 21943319 Gene expression profiles are altered in human papillomavirus-16 E6 D25E-expressing cell lines. Quantification of mRNA of wild-type E6 and E6 D25E in C33A cells by RT-PCR performed using OneStep RT-PCR kits. 2011 Virology journal Figure HPV D25E 46 50 E6;E6 36;43 38;45 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. Variant "E-12" was previously shown to be more prevalent in cancer samples, while the variation 7450 T>C was shown to be statistically more prevalent in cancer samples. 2012 PloS one Figure HPV T7450C 96 104 25096873 Maturation of the human papillomavirus 16 capsid. (d) L1 C175S mutant capsids matured for 1 h. 2014 mBio Figure HPV C175S 7 12 L1 4 6 25096873 Maturation of the human papillomavirus 16 capsid. C175S mutant HPV16 capsids, which cannot form cystine 175 cross-links, provided the following final result starting from 3 wt models, a, d, and e. 2014 mBio Figure HPV C175S 0 5 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. A) C33A cells were transfected with the expression plasmids for EGFP-fused HPV-16 wild type, S243A E2, or EGFP proteins. 2014 PloS one Figure HPV S243A 93 98 E2 99 101 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. C) The S243-mutated E2 protein (S243A) has a shorter half-life than the wild type. 2014 PloS one Figure HPV S243A 32 37 E2 20 22 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. COS-7 cells transfected with plasmids expressing HPV-16 wild type E2, S207-mutated E2 (S207A) or S243-mutated E2 (S243A, S243D, S243N, S243E, S243Q) were visualized by confocal microscopy to determine the location of E2 (green), Brd4 (red) and cellular DNA (blue) during mitosis. 2014 PloS one Figure HPV S207A;S243A;S243D;S243N;S243E;S243Q 87;114;121;128;135;142 92;119;126;133;140;147 E2;E2;E2;E2 66;83;110;217 68;85;112;219 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Localization of EGFP-tagged HPV-16 E2 proteins, including with substitutions of serine 207, serine 243 and R37A/I73A, in mitotic COS-7 cells is shown in green and DNA was stained with DAPI (blue) and visualized by confocal microscopy. 2014 PloS one Figure HPV R37A;I73A 107;112 111;116 E2 35 37 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Expression of the E6 F47R in replication-permissive avian and replication-restrictive mammalian cells. 2015 Journal of translational medicine Figure HPV F47R 22 26 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Immunization was performed with DNA/DNA (G1), DNA/FP (G2), and FP/FP (G3) recombinants expressing the E6F47R. 2015 Journal of translational medicine Figure HPV F47R 104 108 E6 102 104 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. a Paraffin embedded skin sections of UV treated skin from FVB/n-wt, K14-HPV8-E6wt and K14-HPV8-E6K136N mice were stained for T^T (magnification: 400x). 2015 Molecular cancer Figure HPV K136N 97 102 E6 95 97 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. b Representative macroscopical images (upper panel) and histology (lower panel, magnification as indicated) of FVB/n-wt (n = 15), K14-HPV8-E6wt (n = 12) and K14-HPV8-E6K136N animals (n = 50) taken 24 days after UV-irradiation. 2015 Molecular cancer Figure HPV K136N 168 173 E6 166 168 26511842 Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis. The K138N mutant completely abrogated the ability of HPV5-E6 to delay the repair of UVB induced T^T (n = 3 in duplicate; control vs. 2015 Molecular cancer Figure HPV K138N 4 9 E6 58 60 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. (A,B) Bar graphs showing the EP activities of LCR-PT and mutant derivatives carrying either 79del, 2 x 79del, 79del/C7537A, C7732G or 79del/C7732G, as indicated. 2018 Scientific reports Figure HPV C7537A;C7732G;C7732G 116;124;140 122;130;146 LCR 46 49 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. (A) Schematic representation of the Fluc reporter plasmids containing four consecutive E2 binding sites (4 x E2BS), either of the prototype sequence (PT) or carrying the A7874C variation (highlighted in black). 2018 Scientific reports Figure HPV A7874C 170 176 E2 87 89 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. (B) Transactivation of the prototype or A7874C 4 x E2BS-Fluc reporter by E2. 2018 Scientific reports Figure HPV A7874C 40 46 E2 73 75 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Effect of the 79del and C7732G variations on the transcriptional activity of the prototype EP. 2018 Scientific reports Figure HPV C7732G 24 30 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Effect of the two A1-specific variations C7732T and A7874C on the activity of the EP in PHK and HeLa cells. 2018 Scientific reports Figure HPV C7732T;A7874C 41;52 47;58 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Statistical significance relative to LCR-PT and LCR-PT 79del is indicated by asterisks (*) and daggers , respectively. 2018 Scientific reports Figure HPV 79del 55 60 LCR;LCR 37;48 40;51 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The 3xMut LCR carries the variations 79del, C7537A and A7879G. 2018 Scientific reports Figure HPV C7537A;A7879G;79del 44;55;37 50;61;42 LCR 10 13 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The 3xMut LCR contains the three variations 79del/C7537A/A7879G. 2018 Scientific reports Figure HPV C7537A;A7879G 50;57 56;63 LCR 10 13 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The A7874C variation enhances the activity of E2 at E2-binding site 2. 2018 Scientific reports Figure HPV A7874C 4 10 E2;E2 46;52 48;54 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The ability of the prototype (PT) and A7874C 4 x E2BS competitor plasmids to inhibit the transactivation of the A7874C-Fluc reporter plasmid (160 ng) by E2 (10 ng) was measured using increasing amounts of competitor plasmids (0, 80, 160 and 320 ng). 2018 Scientific reports Figure HPV C7874F;A7874C;A7874C 112;38;112 118;44;118 E2 153 155 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Further subcellular localisation studies revealed that all the three other HPV58 E7 variants (V1: T20I/G63S; V2: G41R/G63D; V3: T74A/D76E) and the two artificial mutants (V1A: T20I only; V1B: G63S only) had subcellular localisation similar with that of prototype (P), implicating they might not affect the nuclear functions of HPV58. 2019 Journal of cellular and molecular medicine Figure HPV T20I;G63S;G41R;G63D;T74A;D76E;V1A;T20I;G63S 98;103;113;118;128;133;171;176;192 102;107;117;122;132;137;174;180;196 E7 81 83 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Higher colony-forming ability of HPV58 E7 T20I/G63S variant and prototype in soft agar. 2019 Journal of cellular and molecular medicine Figure HPV G63S;T20I 47;42 51;46 E7 39 41 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. HPV58 E7 T20I/G63S variant exhibited stronger pRb degradation ability. 2019 Journal of cellular and molecular medicine Figure HPV T20I;G63S;G63S;T20I 10;15;14;9 14;19;18;13 E7 6 8 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. HPV58 E7 V1 (T20I/G63S) and prototype (P) demonstrated a significantly higher colony-forming ability in soft agar than the other common circulating variants (V2: G41R/G63D; V3: T74A/D76E), indicating their higher transforming ability (***, P < 0.0001). 2019 Journal of cellular and molecular medicine Figure HPV G63S;T20I;G63D;G41R;T74A;D76E 18;13;167;162;177;182 22;17;171;166;181;186 E7 6 8 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. In this study, we also included artificial single mutants, Variant 1A (V1A; T20I) and Variant 1B (V1B; G63S) to delineate their individual functional roles. 2019 Journal of cellular and molecular medicine Figure HPV V1A;T20I;G63S 71;76;103 74;80;107 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Increased colony-forming ability of HPV58 E7 T20I/G63S variant in primary baby rat kidney (BRK) cells. 2019 Journal of cellular and molecular medicine Figure HPV G63S;T20I 50;45 54;49 E7 42 44 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Our previous studies showed that the three most common circulating HPV58 E7 strains carry amino acid substitutions (in red font) from HPV58 E7 prototype (in black, bold italic font) as follows: threonine (T) at position 20 to isoleucine (I) and glycine (G) at position 63 to serine (S), or designated as T20I/G63S within Variant 1 (V1); G at position 41 to arginine (R) and G at position 63 to aspartic acid (D), or designated as G41R/G63D within Variant 2 (V2); T at position 74 to alanine (A) and D at position 76 to glutamic acid (E), or designated as T74A/D76E within Variant 3 (V3). 2019 Journal of cellular and molecular medicine Figure HPV G63S;T20I;G41R;G63D;T74A;D76E 309;304;430;435;555;560 313;308;434;439;559;564 E7;E7 73;140 75;142 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Single amino acid variation of either T20I (V1A) or G63S (V1B) alone was not sufficient to induce a higher transforming ability than V2 or V3; while their combined effects allowed V1 to achieve a statistically stronger effect than individual variants. 2019 Journal of cellular and molecular medicine Figure HPV V1A;T20I;G63S 44;38;52 47;42;56 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. The effects of different variations on HPV58 E7 half-life was examined by transfection of HPV58 E7 prototype (P), variants (V1: T20I/G63S; V2: G41R/G63D; V3: T74A/D76E) or artificial mutants (V1A: T20I only; V1B: G63S only) into HEK-293 cells. 2019 Journal of cellular and molecular medicine Figure HPV V1A;G63S;T20I;G63D;G41R;T74A;D76E;T20I;G63S 192;133;128;148;143;158;163;197;213 195;137;132;152;147;162;167;201;217 E7;E7 45;96 47;98 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. The effects of HPV58 E7 variations on (A) pRb, and its related pocket protein (B) p107 and (C) p130 degradation were examined by cotransfection of HPV58 E7 prototype (P), variants (V1: T20I/G63S; V2: G41R/G63D; V3: T74A/D76E) or artificial mutants (V1A: T20I only; V1B: G63S only) together with pocket protein plasmid into HEK-293 cells. 2019 Journal of cellular and molecular medicine Figure HPV V1A;G63S;T20I;G63D;G41R;T74A;D76E;T20I;G63S 249;190;185;205;200;215;220;254;270 252;194;189;209;204;219;224;258;274 E7;E7 21;153 23;155 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. The HPV58 E7 V1 (T20I/G63S) variant conferred a higher colony-forming ability to the primary BRK cells as compared with prototype (P) (*P < 0.05), or with other commonly circulating variants (V2: G41R/G63D; V3: T74A/D76E), implicating its higher immortalising power. 2019 Journal of cellular and molecular medicine Figure HPV T20I;G63S;G41R;G63D;T74A;D76E 17;22;196;201;211;216 21;26;200;205;215;220 E7 10 12 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. (A-D) Bar graphs showing the transcriptional activities of LCR-PT, LCR10, and of LCR10 revertants (Rev LCR10) in which either T7365C, C7531T or T7791C has been reverted, as indicated. 2019 Scientific reports Figure HPV T7365C;C7531T;T7791C 126;134;144 132;140;150 LCR;LCR;LCR;LCR 59;67;81;103 62;70;84;106 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. (A-D) Bar graphs showing the transcriptional activities of LCR-PT, LCR7, LCR10, and of LCR10 revertant (Rev LCR10) in which T7365C, C7531T or T7791C were reverted in double or triple combinations. 2019 Scientific reports Figure HPV T7365C;C7531T;T7791C 124;132;142 130;138;148 LCR;LCR;LCR;LCR;LCR 59;67;73;87;108 62;70;76;90;111 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. (B-E) Bar graphs showing the transcriptional activities of LCR-PT and mutant derivatives carrying T7791C or the mBS1 and mBS2 mutations either alone or in combination, as indicated. 2019 Scientific reports Figure HPV T7791C 98 104 LCR 59 62 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. (E,F) Inhibition curves obtained with unlabeled oligonucleotides containing BS1, the variant T7791C site, or the mutant mBS1 site (E) or containing the wild type or mutant BS2 (F). 2019 Scientific reports Figure HPV T7791C 93 99 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Effect of T7791C and of mutation of C/EBPbeta BS1 and BS2 on the transcriptional activity of the prototype EP. 2019 Scientific reports Figure HPV T7791C 10 16 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. LCR7 differs from the triple LCR10 revertant only by the presence of G18A. 2019 Scientific reports Figure HPV G18A 69 73 LCR;LCR 0;29 3;32 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Repression of the EP in PHK either by the combination of T7365C, C7531T and T7791C in LCR10 or by G18A in the LCR of other B-lineage variants. 2019 Scientific reports Figure HPV T7365C;C7531T;T7791C;G18A 57;65;76;98 63;71;82;102 LCR;LCR 86;110 89;113 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. T7791C accounts for the higher activity of LCR10 in C33A, HeLa and U2OS cells. 2019 Scientific reports Figure HPV T7791C 0 6 LCR 43 46 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The location of T7791C in BS1 is indicated by an arrow. 2019 Scientific reports Figure HPV T7791C 16 22 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The T7791C variation is highlighted in black. 2019 Scientific reports Figure HPV T7791C 4 10 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a Comparable neutralizing antibody titers for anti-HPV16 and b anti-HPV52 neutralizing antibody titers elicited by HPV16L1-C175A-HPV52L1-C428A chVLPs (orange column) and HPV16/52 VLPs as a mix (aqua column), administered in serial dosages in mice. 2020 Nature communications Figure HPV C428A;C175A 137;123 142;128 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a High-performance size-exclusion chromatography (HPSEC) profiles and b sedimentation velocity profiles of HPV16 VLPs, HPV52 VLPs, HPV16L1-C175A-HPV52L1-C428A chVLPs, HPV52L1-C175A-HPV16L1-C428A chVLPs, HPV16L1-C175A, HPV52L1-C175A, HPV16L1-C428A, and HPV52L1-C428A. 2020 Nature communications Figure HPV C175A;C428A;C175A;C428A;C175A;C175A;C428A;C428A 139;153;175;189;211;226;241;260 144;158;180;194;216;231;246;265 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a HPV16-specific mAbs, b HPV52-specific mAbs, and c mAbs raised from HPV16L1-C175A-HPV52L1-C428A chVLPs were used to probe epitope variation. 2020 Nature communications Figure HPV C428A;C175A 91;77 96;82 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a HPV16L1-C175A or HPV52L1-C428A constructs lost the capacity for particle self-assembly and infectivity. 2020 Nature communications Figure HPV C175A;C428A 10;27 15;32 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a Transmission electron microscopy (TEM) views show the ratio profiles of various molar pairings of HPV16L1-C175A and HPV52L1-C428A, with better VLP assembly in the pictures along the forward diagonal of the array (see images with red boxes). 2020 Nature communications Figure HPV C175A;C428A 108;126 113;131 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. a-e Three types of capsomeres are involved in the assembly, with a 1:1 molar ratio of the total C175A mutants and the total C428A mutants. 2020 Nature communications Figure HPV C175A;C428A 96;124 101;129 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. b HPV16L1-C175A and HPV52L1-C428A can hybrid-assemble into good particles similar to that of wild-type HPV16L1 and HPV52L1. 2020 Nature communications Figure HPV C175A;C428A 10;28 15;33 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. c Coomassie-stained SDS-PAGE showed the comparable amounts of HPV16 and HPV52 L1 mutants within assembled HPV16L1-C175A-HPV52L1-C428A chVLPs and HPV52L1-C175A-HPV16L1-C428A chVLPs. 2020 Nature communications Figure HPV C175A;C428A;C175A;C428A 114;128;153;167 119;133;158;172 L1 78 80 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. c Dynamic light scattering analysis of HPV16 VLPs, HPV52 VLPs, HPV16L1-C175A-HPV52L1-C428A chVLPs, and HPV52L1-C175A-HPV16L1-C428A chVLPs. 2020 Nature communications Figure HPV C175A;C428A;C175A;C428A 71;85;111;125 76;90;116;130 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. c HPV16L1-C175A and HPV52L1-C428A hybrid-assemble into infective PsVs with involvement of HPV16 or HPV52 L2 or both. 2020 Nature communications Figure HPV C175A;C428A 10;28 15;33 L2 105 107 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. d Differential scanning calorimetry reveals an additional melted phase of the original capsomeres for HPV16L1-C175A-HPV52L1-C428A chVLPs and HPV52L1-C175A-HPV16L1-C428A chVLPs as compared with WT VLPs. 2020 Nature communications Figure HPV C175A;C428A;C175A;C428A 110;124;149;163 115;129;154;168 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. e Micrographs of vitrified HPV16, 52 L1 VLPs and HPV16L1-C175A-HPV52L1-C428A chVLPs (top). 2020 Nature communications Figure HPV C175A;C428A 57;71 62;76 L1 37 39 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16 and HPV52 VLPs, HPV16L1-C175A and HPV52L1-C428A mutants were used as elution markers in the chromatography. 2020 Nature communications Figure HPV C175A;C428A 30;48 35;53 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. HPV16L1-C175A or HPV52L1-C428A alone can assemble into particles with the assistance of the corresponding L2; although, the particles did not appear to be well-formed in TEM view. 2020 Nature communications Figure HPV C175A;C428A 8;25 13;30 L2 106 108 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Left/top panel: mutants of HPV6, HPV16, and HPV52 L1-C175A/C428A were de-thiolated on aa175/aa428 but preserve the thiol group on aa428/aa175, which abrogate their self-assembly into VLPs with respect to the WT HPV L1. 2020 Nature communications Figure HPV C428A;C175A 59;53 64;58 L1;L1 50;215 52;217 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Reconstructed 3D cryo-electron microscopy (cryo-EM) maps of HPV16 and HPV52 L1 VLPs and HPV16L1-C175A-HPV52L1-C428A chVLPs (below). 2020 Nature communications Figure HPV C175A;C428A 96;110 101;115 L1 76 78 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Schematic cartoon (left top region) illustrates the reciprocal linkage of Cys175 and Cys428 from pentamer mutants C428A and C175A, respectively, for chVLP assembly. 2020 Nature communications Figure HPV C428A;C175A 114;124 119;129 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. The unassembled pentamer component nearly disappears in the elution curve of 1:1(molar ratio) mixture of HPV16L1-C175A and HPV52L1-C428A. 2020 Nature communications Figure HPV C175A;C428A 113;131 118;136 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. Tm values for HPV16 VLPs, HPV52 VLPs, HPV16L1-C175A-HPV52L1-C428A chVLPs, HPV52L1-C175A-HPV16L1-C428A chVLPs, and HPV16-C175A and HPV52-C428A L1 proteins were 68.9 C, 64.2 C, 67.7 C, 67.1 C, 66.9 C, and 57.0 C, respectively. 2020 Nature communications Figure HPV C428A;C175A;C428A;C175A;C175A;C428A 60;46;96;82;120;136 65;51;101;87;125;141 L1 142 144 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. The I329T mutation occurred in G1-beta sheets. 2020 Asian Pacific journal of cancer prevention Figure HPV I329T 4 9 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. The S383G mutation result in altered polarity and it occur in isolate BDG-163, in this figure it is mapped together with S383N since it takes place within the same number of amino acid sequence. 2020 Asian Pacific journal of cancer prevention Figure HPV S383G;S383N 4;121 9;126 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. The yellow colors (S81N, N379T, S383N, and Q392H) indicate similar amino acid polarity, and the red color (I329T) indicate altered amino acid polarity. 2020 Asian Pacific journal of cancer prevention Figure HPV S81N;N379T;S383N;Q392H;I329T 19;25;32;43;107 23;30;37;48;112 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Expression plasmids (100 ng) for FLAG-tagged prototype or variant E1 proteins (Q142K, M207I, L262V, and K483A) were transfected into C33A cells together with the prototype E2 expression plasmid (50 ng), the HPV16 origin-containing firefly luciferase reporter plasmid (10 ng), and the Renilla luciferase plasmid (10 ng), and the levels of replication were measured 72 h after transfection. 2020 Frontiers in microbiology Figure HPV Q142K;M207I;L262V;K483A 79;86;93;104 84;91;98;109 E1;E2 66;172 68;174 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Expression plasmids (50 ng) for FLAG-tagged prototype or variant E2 proteins (D153Y, R302T, T357A, and K111R) were transfected into C33A cells together with the prototype E1 expression plasmid (100 ng), the HPV16 origin-containing firefly luciferase reporter plasmid (10 ng), and the Renilla luciferase plasmid (10 ng), and the levels of replication were measured 72 h after transfection. 2020 Frontiers in microbiology Figure HPV D153Y;R302T;T357A;K111R 78;85;92;103 83;90;97;108 E1;E2 171;65 173;67 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Expression plasmids for FLAG-tagged prototype or variant E2 proteins (D153Y, R302T, T357A, and K111R) were transfected into HeLa cells together with the pGL3-P97 reporter plasmid, and transcription was measured 48 h after transfection. 2020 Frontiers in microbiology Figure HPV D153Y;R302T;T357A;K111R 70;77;84;95 75;82;89;100 E2 57 59 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. (A) U2OS-Vec (top panels), E2-WT (middle panels), and E2-S23A were stained with TopBP1 or E2 as indicated. 2021 mBio Figure HPV S23A 57 61 E2;E2;E2 27;54;90 29;56;92 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. (C) The extracts from panel B were immunoprecipitated with TopBP1, and both E2-WT and E2-S23D co-IP with TopBP1 (lanes 2 and 3). 2021 mBio Figure HPV S23D 89 93 E2;E2 76;86 78;88 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. (D) The number of whorls observed in rafts from WT and S23A samples was determined in 10 independent images from each sample. 2021 mBio Figure HPV S23A 55 59 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. (E) Invasive keratinocytes were observed only in the S23A samples; an example is highlighted by a white arrow. 2021 mBio Figure HPV S23A 53 57 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. (E) Staining of U2OS E2-WT (top panels) and U2OS E2-S23A (bottom panels) with pS23-Ab. 2021 mBio Figure HPV S23A 52 56 E2;E2 21;49 23;51 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. An asterisk in panel B and D indicates a P value of less than 0.05 for the difference between the WT and S23A samples. 2021 mBio Figure HPV S23A 105 109 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. An asterisk indicates a P value of less than 0.05 for the difference between the WT and S23A samples. 2021 mBio Figure HPV S23A 88 92 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Following establishment, the growth rates of the HFK+HPV16-WT, HFK+HPV16-S23A, and HFK+HPV16 S23D in monolayer cell culture were similar. 2021 mBio Figure HPV S23A;S23D 73;93 77;97 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The asterisk indicates a significant decrease in E2-S23A interaction with TopBP1 compared with E2-WT (P value < 0.05). 2021 mBio Figure HPV S23A 52 56 E2;E2 49;95 51;97 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The asterisk indicates a significant increase in HPV16-S23A genome copy number (P value < 0.05). 2021 mBio Figure HPV S23A 55 59 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The asterisk indicates a significant reduction in colony size for E2-S23A (P value < 0.05). 2021 mBio Figure HPV S23A 69 73 E2 66 68 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The asterisks in panels B to D indicate a P value of less than 0.05 for the difference between the WT and S23A samples. 2021 mBio Figure HPV S23A 106 110 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The staining seemed more intense for E2 and TopBP1 with E2-WT than with E2-S23A. 2021 mBio Figure HPV S23A 75 79 E2;E2;E2 37;56;72 39;58;74 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The white arrows on the S23A panel point to koilocyte-like cells. 2021 mBio Figure HPV S23A 24 28 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. There was a clear reduction in colony size in three independent HFK donors transfected with HPV16-S23A. 2021 mBio Figure HPV S23A 98 102 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. There was no significant difference in the episomal status of the HPV16 genomes between E2-WT, E2-S23A, or E2-S23D. 2021 mBio Figure HPV S23A;S23D 98;110 102;114 E2;E2;E2 88;95;107 90;97;109 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. TopBP1 co-IPs E2-WT but not E2-S23A. 2021 mBio Figure HPV S23A 31 35 E2;E2 14;28 16;30 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. TopBP1 does not specifically associate with mitotic chromatin in the Vec cells, but it does in the E2-WT and E2-S23A cells. 2021 mBio Figure HPV S23A 112 116 E2;E2 99;109 101;111 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Treatment with the CX4945 abrogates the interaction between TopBP1 and E2-WT (lane 6), but not E2-S23D (lane 5). 2021 mBio Figure HPV S23D 98 102 E2;E2 71;95 73;97 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. LCR:7577T variant and the non-synonymous variants E5:3979C,A4042G, E6:350G are labeled. 2022 Translational oncology Figure HPV A4042G 59 65 LCR;E5;E6 0;50;67 3;52;69 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. (B to D) Bar graphs summarizing the numbers of activated (IFN-gamma+) HPV16 E6-specific CD8+ T cell responses by the various peptides with splenocytes from C57BL/6 mice after vaccination with (B) pcDNA3-CRT/E6 DNA, (C) pcDNA3-CRT/E6(R55K) DNA, or (E) pcDNA3-CRT/E6(R55K)(delK75) DNA. 2022 mBio Figure HPV R55K;R55K 233;265 237;269 E6;E6;E6;E6 76;207;230;262 78;209;232;264 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. 293-Db or 293-AAD cells were transfected with either pcDNA3-CRT/HPV16 E7 or pcDNA-CRT/HPV16E7(N53S) and then were cocultured with either HPV16 E7 (aa 49 to 57) peptide- or HPV16 E7 (aa 11 to 20) peptide-specific CD8+ T cells in the presence of brefeldin A. 2022 mBio Figure HPV N53S 94 98 E7;E7;E7 70;143;178 72;145;180 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Briefly, female AAD mice (5 per group) were vaccinated with 20 mug/mouse of pcDNA3-CRT/E6(R55K)(delK75) DNA vaccine on day 0 through intramuscular injection followed by electroporation. 2022 mBio Figure HPV R55K 90 94 E6 87 89 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Briefly, female C57BL/6 mice (5 per group) were vaccinated with 20 mug/mouse of pcDNA3-CRT/E6, pcDNA3-CRT/E6(R55K), or pcDNA3-CRT/E6(R55K)(delK75) DNA vaccine on day 0 through intramuscular injection followed by electroporation. 2022 mBio Figure HPV R55K;R55K 109;133 113;137 E6;E6;E6 91;106;130 93;108;132 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Characterization of HPV16 E6-specific CD8+ T cell mediated immune responses in HLA-A2 (AAD) transgenic C57BL/6 mice vaccinated with the pcDNA3-CRT/E6(R55K)(delK75) DNA construct. 2022 mBio Figure HPV R55K 150 154 E6;E6 26;147 28;149 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Comparison of CD8+ T cell epitope presentation between wild-type and mutant HPV16 E7(N53S) using 293 cells. 2022 mBio Figure HPV N53S 85 89 E7 82 84 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Histological examination of metastatic tumors of the neck lymph nodes derived from oral/pharyngeal carcinoma in HLA-A2 (AAD) transgenic mice injected with plasmids encoding LucE7(N53S)E6(R55K)(delK75), pKT2-CLP-AKT, pKT2-cMyc, and pCMV-SB100 followed by electroporation. 2022 mBio Figure HPV N53S;R55K 179;187 183;191 E6 184 186 Nasopharyngeal carcinoma 83 108 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Histological examination of tumors formed in HLA-A2 (AAD) transgenic mice injected with plasmids encoding LucE6(R55K)(delK75)/E7(R53S), NRasG12V, and Sleeping Beauty transposase (SB100) followed by electroporation. 2022 mBio Figure HPV R55K;R53S 112;129 116;133 E7 126 128 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Histological examination of tumors formed in HLA-A2 (AAD) transgenic mice injected with plasmids encoding LucE7(N53S)E6(R55K)(delK75), pKT2-CLP-AKT, pKT2-cMyc, and pCMV-SB100 followed by electroporation. 2022 mBio Figure HPV N53S;R55K 112;120 116;124 E6 117 119 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day later, the mice were injected with plasmids encoding LucE6(R55K)(delK75)/E7(R53S), NRasG12V, and SB100 through submucosa of the oral/pharyngeal cavity followed by electroporation. 2022 mBio Figure HPV R55K;R53S 67;84 71;88 E7 81 83 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day later, the mice were injected with plasmids encoding LucE6(R55K)(delK75)/E7(R53S), NRasG12V, and Sleeping Beauty (SB) transposase through submucosa of the oral/pharyngeal cavity followed by electroporation (EP). 2022 mBio Figure HPV R53S;R55K 84;67 88;71 E7 81 83 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day later, the mice were injected with plasmids pKT2-LucE7(N53S)E6(R55K)(delK75), pKT2-CLP-AKT, pKT2-cMyc, and pCMV-SB100 via submucosal injection in the oral/pharyngeal cavity followed by electroporation (EP). 2022 mBio Figure HPV N53S;R55K 63;71 67;75 E6 68 70 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day later, the mice were injected with plasmids pKT2-LucE7(N53S)E6(R55K)(delK75), pKT2-CLP-AKT, pKT2-cMyc, and pCMV-SB100 via submucosal injection in the oral/pharyngeal cavity followed by electroporation. 2022 mBio Figure HPV N53S;R55K 63;71 67;75 E6 68 70 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One day later, the mice were injected with plasmids pKT2-LucE7(N53S)E6(R55K)(delK75), pKT2-CLP-AKT, pKT2-cMyc, and pCMV-SB100 via the submucosal injection in the oral/pharyngeal cavity followed by electroporation. 2022 mBio Figure HPV N53S;R55K 63;71 67;75 E6 68 70 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Summary Kaplan-Meier survival curve for Luc-HPV16E6(R55K)(delK75)/E7(N53S)-expressing tumor-bearing AAD mice. 2022 mBio Figure HPV R55K;N53S 52;69 56;73 E6;E7 44;66 51;68 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. (C) Visualization of amino acid changes: Q14H, D25N, I27R, H78Y and L83V are in licorice. 2022 Scientific reports Figure HPV Q14H;D25N;I27R;H78Y;L83V 41;47;53;59;68 45;51;57;63;72 35115618 Molecular insights into the interaction of HPV-16 E6 variants against MAGI-1 PDZ1 domain. Zoom visualization of amino acid changes: Q14H, D25N, I27R, E29Q, H78Y and L83V. 2022 Scientific reports Figure HPV E29Q;Q14H;D25N;I27R;H78Y;L83V 60;42;48;54;66;75 64;46;52;58;70;79 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. For instance, E6-L83V is not enriched in Italian or Czech women with cancer. 2002 British journal of cancer Discussion HPV L83V 17 21 E6 14 16 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. In addition, E6-L83V is evenly distributed in precursor lesions and cancer in a German study (Nindl et al, 1999). 2002 British journal of cancer Discussion HPV L83V 16 20 E6 13 15 11870518 Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. The HPV16 E6-L83V variant, on the other hand, is the most common E6 variant in north European women and correlates statistically with the severity of cervical disease in three Scandinavian countries, i.e. 2002 British journal of cancer Discussion HPV L83V 13 17 E6;E6 10;65 12;67 Cervical diseases 150 166 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Furthermore, recent quantitative binding studies have shown that the C24G mutant retains 30% of the pRb-binding affinity of the wild-type E7 protein (apparent KDs of 14 and 4.5 nM respectively) (Dong et al, 2001). 2004 British journal of cancer Discussion HPV C24G 69 73 E7 138 140 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. However, if C24G retains or accentuates some difference in binding preference between the pocket proteins then the direct involvement of p107 or p130 cannot be excluded. 2004 British journal of cancer Discussion HPV C24G 12 16 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. However, the C24G mutant protein is able to stimulate proliferation in immortalized rodent fibroblasts (Caldeira et al, 2000). 2004 British journal of cancer Discussion HPV C24G 13 17 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. In organotypic raft culture C24G was joined by S31G/S32G in possessing the ability to induce tetrasomy, which was predominantly suprabasal, to levels comparable with wild-type protein. 2004 British journal of cancer Discussion HPV C24G;S31G;S32G 28;47;52 32;51;56 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. It is not clear why the S31G/S32G mutant cannot induce tetrasomy in monolayer but is capable of doing so in raft culture, but this differential ability is compatible with our previous hypothesis that the mechanisms of induction of basal and suprabasal tetrasomy are different (Southern et al, 2001). 2004 British journal of cancer Discussion HPV S31G;S32G 24;29 28;33 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. Only the S31G/S32G mutant gave a raft morphology indicating both proliferation (a thickened raft) and differentiation. 2004 British journal of cancer Discussion HPV S31G;S32G 9;14 13;18 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The absence of tetrasomy in rafts expressing C-terminal mutants A50S and S71I is consistent with the observation that, despite their ability to bind to pRb, C-terminal mutations inhibit the ability of E7 to induce S phase and endoreduplication in differentiated keratinocytes and is compatible with the requirement for inactivation of both pRb and p21 by HPV 16 E7 in order to bypass cell-cycle arrest (Helt et al, 2002). 2004 British journal of cancer Discussion HPV A50S;S71I 64;73 68;77 E7;E7 201;362 203;364 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The difference between the findings for this mutant and those for C24G may in part be related to a change (possibly conformational) that impinges on some other E7 function additional to pocket-protein binding that is not affected by C24G. 2004 British journal of cancer Discussion HPV C24G;C24G 66;233 70;237 E7 160 162 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The induction of tetrasomy by C24G, S31G/S32G and wild-type E7 demonstrates that this property is not related to the ability of the E7 protein to disrupt keratinocyte differentiation. 2004 British journal of cancer Discussion HPV C24G;S31G;S32G 30;36;41 34;40;45 E7;E7 60;132 62;134 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The one mutant protein that did not cause a reduction in tetrasomy was C24G. 2004 British journal of cancer Discussion HPV C24G 71 75 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The other mutants analysed are able to bind to pRb but, with the exception of S31G/S32G in raft culture, are unable to induce tetrasomy. 2004 British journal of cancer Discussion HPV S31G;S32G 78;83 82;87 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. The other rafts were either proliferative but relatively undifferentiated (wild-type, A50S, S71I) or nonproliferative (vector, H2P, Delta6-10, Delta21-24, C24G), in agreement with the findings of Demers et al (1996). 2004 British journal of cancer Discussion HPV H2P;A50S;S71I;C24G 127;86;92;155 130;90;96;159 15138476 Induction of tetrasomy by human papillomavirus type 16 E7 protein is independent of pRb binding and disruption of differentiation. What is the functional difference between the C24G and the Delta21-24 mutations? Both mutant proteins are unable to disrupt keratinocyte differentiation (Demers et al, 1996 and see Figure 3A), transactivate the adenovirus E2 promoter (Edmonds and Vousden, 1989; Phelps et al, 1992) or transform cells in vitro (Edmonds and Vousden, 1989; Phelps et al, 1992). 2004 British journal of cancer Discussion HPV C24G 46 50 E2 222 224 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Our studies indicated that the K292R mutant showed reduced repressive activity in a transient reporter assay compared to wild-type E2 (Fig 6A, right panel). 2008 Virology Discussion HPV K292R 31 36 E2 131 133 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). Since this mutant was not deficient in expression, specific DNA binding, or in subcellular localization, we conclude that the reduced transcriptional activity of 16E2 K292R is most likely caused by its inability to be sumoylated; these results indicate that the transactivation activity of E2 is enhanced by sumoylation. 2008 Virology Discussion HPV K292R 167 172 E2 290 292 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). We did not observe any gross changes in subcellular localization between the wild-type 16E2 and the K292R mutant form that could not be sumoylated, but more detailed studies will be required to assess possible subtle effects of sumoylation on E2 localization within the nucleus. 2008 Virology Discussion HPV K292R 100 105 E2 243 245 18619639 Modification of papillomavirus E2 proteins by the small ubiquitin-like modifier family members (SUMOs). We found that the K292R mutant, which was not sumoylated, had reduced transactivation activity compared to wild-type 16E2. 2008 Virology Discussion HPV K292R 18 23 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Indeed, CaSki cells (R10G/L83V) more than SiHa cells (L83V) have been reported to undergo apoptosis when deprived of cell anchorage. 2009 Virology Discussion HPV L83V;R10G;L83V 26;21;54 30;25;58 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Nevertheless both Q14H/H78Y/L83V and R10G/L83V demonstrated significantly higher levels of late apoptosis than E6 prototype and L83V, which seems unusual but is not unprecedented. 2009 Virology Discussion HPV Q14H;H78Y;L83V;L83V;R10G;L83V 18;23;28;42;37;128 22;27;32;46;41;132 E6 111 113 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Our data may explain the high prevalence of certain HPV16 E6 variants in populations and in high-grade cervical disease worldwide, especially with respect to the Asian-American variant Q14H/H78Y/L83V. 2009 Virology Discussion HPV Q14H;H78Y;L83V 185;190;195 189;194;199 E6 58 60 Cervical diseases 92 119 18986660 Human papillomavirus 16 E6 variants differ in their dysregulation of human keratinocyte differentiation and apoptosis. Using low calcium and serum-free semisolid medium, E6 prototype and L83V resisted apoptosis more than did the vector in the context of the NIKS cell line. 2009 Virology Discussion HPV L83V 68 72 E6 51 53 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. observed frequencies of 47% for the E-T350G and 8% for the E-350T variants. 2009 Infectious agents and cancer Discussion HPV T350G 38 43 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The E-P A334G variant appears to be more oncogenic, because the proportion of HSIL and ICC lesions were clearly higher for them than with the E-P Ref variants (Table 4). 2009 Infectious agents and cancer Discussion HPV A334G 8 13 Squamous intraepithelial lesions;Cervical carcinoma 78;87 82;90 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The non synonymous A404T substitution, observed only in one sequence close to the E-P Ref, generates the I101F amino acid change in the E6 protein. 2009 Infectious agents and cancer Discussion HPV A404T;I101F 19;105 24;110 E6 136 138 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. The synonymous A334G, the most frequent of the novel single nucleotide changes found in 22 E subtype sequences (57.9%) is phylogenetically close to the E-P Ref prototype and appear to identify an HPV16 variant characteristic of the region. 2009 Infectious agents and cancer Discussion HPV A334G 15 20 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. To verify if E-P A334G sequences indeed correspond to a new variant, the complete viral genome must be cloned and sequenced. 2009 Infectious agents and cancer Discussion HPV A334G 17 22 19216802 Human papillomavirus type 16 variants in cervical intraepithelial neoplasia and invasive carcinoma in San Luis Potosi City, Mexico. We identified four HPV16 variants in San Luis Potosi City: E-P (n = 27, 71.1%), E-T350G (n = 7, 18.4%), E-C188G (n = 2, 5.3%) and AA-a (n = 2, 5.3%), whereas Berumen et al. 2009 Infectious agents and cancer Discussion HPV T350G;C188G 82;106 87;111 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. The C92A mutant of E2-25K used in this study blocks both the ubiquitin conjugating activity and ubiquitin ligase activity of E2-25K. 2010 Virology Discussion HPV C92A 4 8 E2;E2 19;125 21;127 19906396 Destabilization of Rb by human papillomavirus E7 is cell cycle dependent: E2-25K is involved in the proteolysis. The dominant negative Cys-Ala mutant of E2-25K, C92A E2-25K efficiently blocked the E7-induced degradation of Rb. 2010 Virology Discussion HPV C92A 48 52 E2;E2;E7 40;53;84 42;55;86 21159359 Expression of human papillomavirus type 16 E7 is sufficient to significantly increase expression of angiogenic factors but is not sufficient to induce endothelial cell migration. Alternatively, the pRb-independent activity of E7 could be due to degradation of p107 or the interactions, for example with AP-1or histone deacetylases, which are retained with the HPV 16 E7C24G mutant. 2011 Virology Discussion HPV C24G 190 194 E7;E7 47;188 49;190 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Activities of these variants were compared with the L83V variant, which is highly represented in cancer of European populations. 2011 Molecular cancer Discussion HPV L83V 52 56 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Although expression of K10 was restricted to the suprabasal layers of the raft cultures, a significantly lower expression was detected in the E6 NIKS with the rare variants R10G, R48W and R8Q. 2011 Molecular cancer Discussion HPV R10G;R8Q;R48W 173;188;179 177;191;183 E6 142 144 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. As our data shows R48W with significantly higher ability to induce apoptosis than L83V, has low prevalence in previously studied European populations (identified in only one ICC of an Italian women). 2011 Molecular cancer Discussion HPV R48W;L83V 18;82 22;86 Cervical carcinoma 174 177 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Expression of K14 was more confined to the basal cells except for R8Q, which showed strong expression of both K5 and K14 throughout the rafts suggesting that the cells do have a basal cell phenotype. 2011 Molecular cancer Discussion HPV R8Q 66 69 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. High activity of the Asian American variant Q14H/H78Y/L83V in apoptosis induction was suggested to be related to its high persistence and increased risk of progression to cancer (reported to be 20-fold higher than that of prototype E6). 2011 Molecular cancer Discussion HPV Q14H;H78Y;L83V 44;49;54 48;53;58 E6 232 234 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. In a recent study, L83V-related variants of HPV 16 E6 were evaluated for alteration of NIKS differentiation, it was demonstrated that all tested E6 proteins induced hyperplastic cultures with abnormal stratification. 2011 Molecular cancer Discussion HPV L83V 19 23 E6;E6 51;145 53;147 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. In an earlier investigation NIKS transduced with the E6 variants Q14H/H78Y/L83V and R10G/L83V demonstrated significantly higher levels of late apoptotic cells when suspended in methylcellulose than L83V. 2011 Molecular cancer Discussion HPV Q14H;H78Y;L83V;R10G;L83V;L83V 65;70;75;84;89;198 69;74;79;88;93;202 E6 53 55 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. In this respect, strong activity in suppression of keratinocyte differentiation as that exhibited by R8Q may not be favorable for viral persistence, which may explain in part the rare detection of the R8Q variant in previously studied populations. 2011 Molecular cancer Discussion HPV R8Q;R8Q 101;201 104;204 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. NIKS transduced with the minor E6 variants, R8Q, R10G and particularly R48W, exhibited higher apoptotic figures when suspended in low calcium and serum-free semisolid medium, indicating their ability to augment anoikis. 2011 Molecular cancer Discussion HPV R10G;R8Q;R48W 49;44;71 53;47;75 E6 31 33 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. Previous studies with site directed mutants demonstrated that other amino acid changes in the same positions as those of R8Q and R10G, did impair the ability of E6 to induce p53 degradation. 2011 Molecular cancer Discussion HPV R8Q;R10G 121;129 124;133 E6 161 163 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. R10G and R48W induced hyperplastic proliferation similar to that induced by the high prevalence type L83V, whereas the R8Q cultures had a unique phenotype, characterized by lack of stratification. 2011 Molecular cancer Discussion HPV R10G;R8Q;R48W;L83V 0;119;9;101 4;122;13;105 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The largest increase was in R48W and was statistically significant when compared to the vector cells. 2011 Molecular cancer Discussion HPV R48W 28 32 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The rare variant R8Q exhibited significantly higher ability to augment Wnt/TCF-beta-catenin transcription, an activity that could be of advantage in keratinocyte transformation. 2011 Molecular cancer Discussion HPV R8Q 17 20 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. The similarities in the modulation of DNA damage responses between the common L83V and the rare E6 variants, both in terms of suppression of p53 accumulation and overcoming growth arrest, strongly suggest that these functions of E6 cannot be compromised to initiate the carcinogenic process. 2011 Molecular cancer Discussion HPV L83V 78 82 E6;E6 96;229 98;231 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. This research also demonstrates that similar to L83V, the rare E6 variant proteins were able to both suppress the elevation in levels of the p53 protein and override p53-mediated growth-arrest that normally is induced by actinomycin D. 2011 Molecular cancer Discussion HPV L83V 48 52 E6 63 65 21702904 Rare human papillomavirus 16 E6 variants reveal significant oncogenic potential. This was more pronounced in the L83V and the R48W cultures. 2011 Molecular cancer Discussion HPV L83V;R48W 32;45 36;49 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. Another E7 mutant, C24G, which is impaired in binding and inactivating the pRB family members, can bind to Miz-1 and inhibit Miz-1-dependent p21Cip1 expression similar to wild-type E7. 2012 Virology Discussion HPV C24G 19 23 E7;E7 8;181 10;183 22099967 The human papillomavirus type 16 E7 oncoprotein targets Myc-interacting zinc-finger protein-1. In keeping with these data, we showed in the present study that the E7 cd2 mutant C24G, which is deficient in binding to pRB, behaves as wild-type E7 in the functional interaction between E7 and Miz-1. 2012 Virology Discussion HPV C24G 82 86 E7;E7;E7 68;147;188 70;149;190 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. E6 with both the R10G and L83 alteration, which 9/12 TSCC had in this study, behaved similar to the prototype. 2012 PloS one Discussion HPV R10G 17 21 E6 0 2 Tonsillar squamous cell carcinoma 53 57 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Further studies are needed to investigate if the R10G variant may be more common in oral as compared to cervical samples. 2012 PloS one Discussion HPV R10G 49 53 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Here, a higher prevalence of L83V was found in TSCC compared to CC and CS, while the prevalence in the latter categories were roughly in agreement with previous reports. 2012 PloS one Discussion HPV L83V 29 33 Tonsillar squamous cell carcinoma;Cervical carcinoma 47;64 51;66 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. However, while E6 with R10G has a decreased binding to E6BP (E6-binding protein) and reduced ability to induce Bax degradation, E6 with L83V E6 has an increased binding to E6BP and retained ability to induce Bax degradation compared to prototype HPV16 E6. 2012 PloS one Discussion HPV R10G;L83V 23;136 27;140 E6;E6;E6;E6;E6 15;61;128;141;252 17;63;130;143;254 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. In addition, the R10G site has also been reported to be essential for nuclear localization signal. 2012 PloS one Discussion HPV R10G 17 21 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. In the present study no significant difference was observed with regard to the 3-year disease-free survival among the patients with TSCC carrying or not carrying HPV16 E6 R10G variant. 2012 PloS one Discussion HPV R10G 171 175 E6 168 170 Tonsillar squamous cell carcinoma 132 136 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. In this study, L83V was the most common variant in all types of material, which is in line with many other observations both in the genital and head and neck region. 2012 PloS one Discussion HPV L83V 15 19 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. It has been demonstrated that both E6 with R10G and L83V retain the ability to abrogate growth arrest, and strongly reduce the steady state levels of p53. 2012 PloS one Discussion HPV R10G;L83V 43;52 47;56 E6 35 37 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. More specifically, the rare R10G variant was significantly more common in TSCC than in CC, and was frequently in combination with the L83V variant in the former tumors. 2012 PloS one Discussion HPV R10G;L83V 28;134 32;138 Cervical carcinoma;Tonsillar squamous cell carcinoma 87;74 89;78 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Notably, although the majority of patients with TSCC were men, and only women have CC, there were no sex-related differences in the relative frequencies of R10G in TSCC. 2012 PloS one Discussion HPV R10G 156 160 Tonsillar squamous cell carcinoma;Tonsillar squamous cell carcinoma;Cervical carcinoma 48;164;83 52;168;85 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Noteworthy, we did not find any significant correlation between the presence or absence of the L83V variant and the 3-year disease free survival of the patients. 2012 PloS one Discussion HPV L83V 95 99 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Other variants of HPV16 E6, especially L83V, differ geographically and may affect the pathological risk. 2012 PloS one Discussion HPV L83V 39 43 E6 24 26 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Several studies have been performed on the R10G variant in cervical cancers. 2012 PloS one Discussion HPV R10G 43 47 Cervical carcinoma 59 75 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The collected data indicate that virtually all patients carrying the R10G variant had Sweden as their country of origin, however we do not have information if they have moved to Stockholm from other parts of Sweden. 2012 PloS one Discussion HPV R10G 69 73 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The fact that the otherwise rare HPV16 E6 variant R10G was observed in TSCC, but not in CC in patients diagnosed at the same time period from the same hospital is striking. 2012 PloS one Discussion HPV R10G 50 54 E6 39 41 Cervical carcinoma;Tonsillar squamous cell carcinoma 88;71 90;75 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The HPV 16 European lineage was dominating and the L83V variant was very common in all three categories of samples. 2012 PloS one Discussion HPV L83V 51 55 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The R10G mutation is in the N-terminal end, important for p53 binding and degradation, and it has also been shown to result in a modified B/T cell epitope. 2012 PloS one Discussion HPV R10G 4 8 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. The reason for the high frequency of R10G variant in TSCC from Stockholm, as compared to CC from both Stockholm and other areas, is unknown. 2012 PloS one Discussion HPV R10G 37 41 Tonsillar squamous cell carcinoma;Cervical carcinoma 53;89 57;91 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. There are however several studies demonstrating an association between L83V and increased virus persistence, and risk of cervical neoplasia and cancer progression. 2012 PloS one Discussion HPV L83V 71 75 Cervical carcinoma 121 139 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. Thus, several different features of the R10G site may influence cancer progression, even though it is unclear to what degree. 2012 PloS one Discussion HPV R10G 40 44 22558401 Human papillomavirus (HPV) 16 E6 variants in tonsillar cancer in comparison to those in cervical cancer in Stockholm, Sweden. We found that HPV16 R10G was relatively common in TSCC, absent in CC and rare in CS. 2012 PloS one Discussion HPV R10G 20 24 Cervical carcinoma;Tonsillar squamous cell carcinoma 66;50 68;54 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. A previous study found that L83V appears to enhance MAPK signaling and L83V is involved in oncogenic Ras-mediated transformation, efficient degradation of Bax and binding to E6BP and decreased binding to human discs large protein (hDlg). 2012 PloS one Discussion HPV L83V;L83V 28;71 32;75 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. For example, E2 T310K has been linked to high grade histology in cervical carcinoma. 2012 PloS one Discussion HPV T310K 16 21 E2 13 15 Cervical carcinoma 65 83 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. For example, the L83V polymorphism located within the epitope which binds to MHC molecules was found to be associated with cervical tumor development. 2012 PloS one Discussion HPV L83V 17 21 Cervical carcinoma 123 137 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. In addition, this L83V polymorphism also appears to interact with natural human variations in the P53 genes (in particular codon 72 polymorphism) to confer differences in cervical cancer risk. 2012 PloS one Discussion HPV L83V 18 22 Cervical carcinoma 171 186 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. It is of interest that the only candidate site which was positively selected N29S is located within the domains which are important for the transforming activity of this protein and these domains are know to be involved in binding retinoblastoma suppressor protein (pRB). 2012 PloS one Discussion HPV N29S 77 81 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. Position E113D mutation was also implied in invasive cervical carcinoma. 2012 PloS one Discussion HPV E113D 9 14 Adenocarcinoma 44 71 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. Previous studies have found that mutations in the amino acid position L83V may play an important role in cancer progression. 2012 PloS one Discussion HPV L83V 70 74 22574185 Whole genome sequencing and evolutionary analysis of human papillomavirus type 16 in central China. The other positively selected site of interest is amino position D25E. 2012 PloS one Discussion HPV D25E 65 69 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. From all these studies it appears that the seemingly insignificant, silent change 109 T>C can very possibly affect the viral oncogene expression and its regulation, which probably influences viral life cycle and oncogenic potential of the E-C109/G350 and related variants. 2012 PloS one Discussion HPV T109C 82 89 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. From this study and the results found in the literature on the possible effects of the 109 T>C variation, it appears that this is not just an insignificant silent change but, on the contrary, affects several mechanisms of the viral life cycle. 2012 PloS one Discussion HPV T109C 87 94 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. In any case, the Indian variant E-12 was more prevalent in cancer, and the 7450 T>C change significantly more so, making it unlikely that any of those changes (350, 3410, 3979, 4042, 4228, 4938, 5226, 6434, 7193, 7521 and 7450) could be responsible for the association of the E1-1374 63nt E-G350 variant with lower grade lesions. 2012 PloS one Discussion HPV T7450C 75 83 E1 276 278 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. In either case, the consistent presence of change 350 T>G in the E1-1374 63nt E-G350 variant is unlikely to be able to significantly decrease the association with HSIL of this variant or increase it with LSIL. 2012 PloS one Discussion HPV T350G 50 57 E1 65 67 Squamous intraepithelial lesions;Squamous intraepithelial lesions 163;204 167;208 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. In this case, the 109 T>C substitution changes the phenylalanine codon TTT to the only other phenylalanine codon TTC. 2012 PloS one Discussion HPV T109C 18 25 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. More interesting is the report that the change 7450 T>C, within the LCR, is associated with cervical cancer. 2012 PloS one Discussion HPV T7450C 47 55 LCR 68 71 Cervical carcinoma 92 107 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. Of all changes from the reference found in the HPV16 E1-1374 63nt variant, the 350 T>G change has been reported most often. 2012 PloS one Discussion HPV T350G 79 86 E1 53 55 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. Some studies linked 350 T>G to higher oncogenic potential or viral persistence, but others did not. 2012 PloS one Discussion HPV T350G 20 27 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The 109 T>C change corresponds to the sequence ATG TTC CA, which disrupts the consensus sequence that was found to accept only T in all oligonucleotides that bind AP1 at that changed position. 2012 PloS one Discussion HPV T109C 4 11 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The 109 T>C change is the signature variation of the E-C109/G350 variant. 2012 PloS one Discussion HPV T109C 4 11 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The change 63 E>D (glutamate to aspartate) was also predicted to be situated at the surface of the protein (Figure 2B, 2D) and might also be involved in E1 protein-protein interactions. 2012 PloS one Discussion HPV E63D 11 17 E1 153 155 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The Indian variant E-12, that contains 7450 T>C change, was more prevalent in cancer cases than controls (38.2% vs. 2012 PloS one Discussion HPV T7450C 39 47 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The only differences were the silent variations at position 24 C>G within the LCR and 109 T>C within the E6 region. 2012 PloS one Discussion HPV C24G;T109C 60;86 66;93 LCR;E6 78;105 81;107 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. The remaining 2 changes are the E1-1374 63nt duplication itself and the 1053 A>C change, which leads to the substitution 63 E>D in the E1 protein. 2012 PloS one Discussion HPV A1053C;E63D 72;121 80;127 E1;E1 32;135 34;137 22911739 Characterization and whole genome analysis of human papillomavirus type 16 e1-1374^63nt variants. This was most evident for the frequently studied 350 T>G variation, since the E1-1374 63nt duplication is exclusively linked with this variation. 2012 PloS one Discussion HPV T350G 49 56 E1 78 80 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. A previous study from southern China (Hong Kong) also revealed that substitutions T20I and/or G63S were associated with a 6.9-fold increase in odds ratio for developing invasive cervical cancer, and the age of patients were significantly younger than those infected with other variants of HPV58. 2013 International journal of cancer Discussion HPV T20I;G63S 82;94 86;98 Cervical carcinoma 169 193 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Amino acid substitution(s) T20I and/or G63S at E7 is(are) associated with a higher risk for CIN3 and invasive cervical cancer. 2013 International journal of cancer Discussion HPV T20I;G63S 27;39 31;43 E7 47 49 Cervical intraepithelial neoplasia;Cervical carcinoma 92;101 96;125 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Isolates carrying G63S and/or T20I were found to have an independent increase in risk for CIN3 and invasive cervical cancer. 2013 International journal of cancer Discussion HPV G63S;T20I 18;30 22;34 Cervical intraepithelial neoplasia;Cervical carcinoma 90;99 94;123 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Only one variant harbored G63S alone without T20I. 2013 International journal of cancer Discussion HPV G63S;T20I 26;45 30;49 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. The high-risk mutations T20I and G63S were found in 33% of isolates in Asia and 10% in Americas but rare in Europe (3%) and Africa (0%). 2013 International journal of cancer Discussion HPV T20I;G63S 24;33 28;37 23136059 Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. The second observation was that E7-C with an amino acid substitution signature of T20I and G63S was commonly found in Asia (34%) and Americas (11%) but rare elsewhere. 2013 International journal of cancer Discussion HPV T20I;G63S 82;91 86;95 E7 32 34 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Among HPV 52 isolates, the LCR T7624G/C substitution was detected in all of the samples tested. 2012 International journal of molecular sciences Discussion HPV T7624C;T7624G 31;31 39;39 LCR 27 30 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Among the four mutations, only A379G (K93R) was nonsynonymous. 2012 International journal of molecular sciences Discussion HPV A379G;K93R 31;38 36;42 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. Except for C6917A, all the other mutations in the HPV 52 L1 gene were not described elsewhere. 2012 International journal of molecular sciences Discussion HPV C6917A 11 17 L1 57 59 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. In accordance with Xin's report, the unique A379G (K93R) variation was located in the strand H1 and the third predicted zinc finger of E6 protein and occurred in almost all of the HPV 52 positive samples. 2012 International journal of molecular sciences Discussion HPV A379G;K93R 44;51 49;55 E6 135 137 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The mutation G350A detected in the E6 gene has been reported as G350T in the study of Ding et al. 2012 International journal of molecular sciences Discussion HPV G350A;G350T 13;64 18;69 E6 35 37 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The novel mutations of C5640T, A5641T and G5642A, which lead to amino acid change of Q26L, were detected in nine strains from patients with HSIL. 2012 International journal of molecular sciences Discussion HPV C5640T;A5641T;G5642A;Q26L 23;31;42;85 29;37;48;89 Squamous intraepithelial lesions 140 144 23203106 Genomic polymorphism of human papillomavirus type 52 in women from Northeast China. The Q26L mutation was located in the strand beta-B1 of the L1 protein, which may suggest that the variants were established to escape neutralization. 2012 International journal of molecular sciences Discussion HPV Q26L 4 8 L1 59 61 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. A recent study by Todorovic and colleagues suggests that the N92S substitution may have functional significance. 2013 PloS one Discussion HPV N92S 61 65 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. Both the C14A and V15L amino acid substitutions occur in the first amino-terminal alpha-helix of the TAD domain. 2013 PloS one Discussion HPV C14A;V15L 9;18 13;22 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. In addition, we also found a novel G to A transition at nt6906. 2013 PloS one Discussion HPV G6906A 35 62 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. In our data set, the most frequent variation was the C to G silent mutation at nt287. 2013 PloS one Discussion HPV C287G 53 84 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. in Taiwan, who reported the identical nucleotide variation, and suggests that the C to G variation at nt287 may be a common mutation worldwide. 2013 PloS one Discussion HPV C287G 82 107 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. In the L1 coding region, one A to G transition at nt5503 and four C to G transversions were found. 2013 PloS one Discussion HPV A5503G 29 56 L1 7 9 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. The N92S AA substitution is in the region linking CD2 and CD3. 2013 PloS one Discussion HPV N92S 4 8 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. The transition C to T at nt640 is a silent mutation, and A to G transition at nt864, leading to a N92S AA substitution. 2013 PloS one Discussion HPV C640T;A864G;N92S 15;57;98 30;83;102 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. These changes resulted in two AA changes: C14A and V15L. 2013 PloS one Discussion HPV C14A;V15L 42;51 46;55 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. These variations result in L648C and R649V AA substitutions in the E1 coding region, especially, in the C-terminal helicase/ATPase region, which unwinds the HPV genome to allow for replication. 2013 PloS one Discussion HPV L648C;R649V 27;37 32;42 E1 67 69 23451059 Sequence variation analysis of HPV-18 isolates in southwest China. This residue was predicted to be exposed on the surface of the CR3 domain of E7 protein, and its mutation in HPV-16 (P92A) led to reduced dimerization of E7 (according to yeast two-hybrid analysis) as well as increased transformation potential. 2013 PloS one Discussion HPV P92A 117 121 E7;E7 77;154 79;156 23609590 Human papillomavirus prevalence in invasive anal cancers in the United States before vaccine introduction. in anal neoplasia tissue from a mostly HIV positive population, which may support their hypothesis that infection with the E-G131G or E-G131T genotypes pose elevated risk for malignant progression. 2013 Journal of lower genital tract disease Discussion HPV G131G;G131T 125;136 130;141 Anal neoplasia 3 17 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Additionally, E6 variants R10G/L83V and Q14H/H78Y/L83V which are frequently detected in our study, were more prone to undergo cell-detachment-induced apoptosis than E6 prototype in a model of human normal immortalized keratinocytes (NIKS) and has a greater in vitro ability to suppress keratinocyte differentiation responses and to induce p53 degradation than the prototype. 2013 BMC infectious diseases Discussion HPV R10G;L83V;L83V;Q14H;H78Y 26;31;50;40;45 30;35;54;44;49 E6;E6 14;165 16;167 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Additionally, in another study, the HPV 16 E6 variant G131 (R10G) was demonstrated to alter a B*07 binding epitope such that it may influence immune recognition by cytotoxic T lymphocytes. 2013 BMC infectious diseases Discussion HPV R10G 60 64 E6 43 45 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Against the above background of higher pathogenicity associated with the L83V variant, the finding of our study reiterates the same. 2013 BMC infectious diseases Discussion HPV L83V 73 77 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Also, this L83V polymorphism appears to interact with natural human variations in the p53 genes (in particular codon 72 polymorphism) to confer differences in cervical cancer risk. 2013 BMC infectious diseases Discussion HPV L83V 11 15 Cervical carcinoma 159 174 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. In some European populations, HPV16 E350G variant was strongly associated with the oncogenicity and persistency of HPV16 infection. 2013 BMC infectious diseases Discussion HPV E350G 36 41 HPV infections 115 130 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Indeed, it has been suggested that women with three distinct HLA class I alleles, namely HLA-B*44, HLA-B*51, or HLA-B*57 who were infected with the HPV16 E6 variant L83V had an approximately four to five fold increased risk for cancer compared with controls. 2013 BMC infectious diseases Discussion HPV L83V 165 169 E6 154 156 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Indeed, the most frequently observed mutation in our study was L83V which is detected in 65% of cases (67/103), either alone (15.5% of cases) or along with other mutations (49.5% of cases). 2013 BMC infectious diseases Discussion HPV L83V 63 67 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Interestingly, the E113D (A442C) was detected in 37.9% of samples and was exclusively found in the European variant (E350G/442C). 2013 BMC infectious diseases Discussion HPV E113D;E350G;A442C 19;117;26 24;122;31 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Moreover, HPV16 E350G variant was found to display more efficient degradation of Bax (protein regulated by p53) and binding to E6-BP (E6 binding protein) and decreased binding to human discs large protein (hDlg). 2013 BMC infectious diseases Discussion HPV E350G 16 21 E6;E6 127;134 129;136 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. Most recently, Bayesian analysis identified several important amino acid positions that may be driving adaptive selection in the HPV 16 population, including R10G, L83V, and E113D in the E6 gene. 2013 BMC infectious diseases Discussion HPV R10G;E113D;L83V 158;174;164 162;179;168 E6 187 189 23953248 Analysis of mutations in the E6 oncogene of human papillomavirus 16 in cervical cancer isolates from Moroccan women. The most prevalent non-synonymous variants were L83V (T350G), H78Y (C335T), E113D (A442C), Q14D (C143G/G145T) and R10I (G132T), and were observed respectively in 65%, 41.8%, 37.9%, 30.1% and 23.3%of total samples. 2013 BMC infectious diseases Discussion HPV E113D;R10I;L83V;T350G;H78Y;C335T;A442C;Q14D;C143G;G145T;G132T 76;114;48;54;62;68;83;91;97;103;120 81;118;52;59;66;73;88;95;102;108;125 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. Because of the strong cosegregation of the co-variations of G7193T, 7434CIns, C7436T, G7521A, and 7863Adel, it is impossible to determine if each variation in it was individually responsible for risk for developing CIN2,3. 2013 BMC cancer Discussion HPV G7193T;C7436T;G7521A 60;78;86 66;84;92 Cervical intraepithelial neoplasia 215 221 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In Europe, the variants harboring the HPV16 E6 gene substitution of T350G (L83V) seem to be associated with an increased risk of persistent infection and cytological progression to CIN 2, 3 and SCC. 2013 BMC cancer Discussion HPV T350G;L83V 68;75 73;79 E6 44 46 Cervical intraepithelial neoplasia;Squamous cell carcinoma 181;194 186;197 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In our study, phylogenetic analysis of the E6 gene showed an extremely higher prevalence of the As lineage (49.7%), followed by E-prototype lineage (36.4%), E350G-lineage (9.9%), E131G-lineage (3.0%) and Af-1 variant (4.3%). 2013 BMC cancer Discussion HPV E350G;E131G 157;179 162;184 E6 43 45 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In our study, the alone L83V variation in HPV16 E6 was not associated with an increased risk of CIN2,3, but together with R10G, the nonsynonymous variations R10G/L83V were associated significantly with an increased risk for developing CIN2,3. 2013 BMC cancer Discussion HPV R10G;L83V;L83V;R10G 122;24;162;157 126;28;166;161 E6 48 50 Cervical intraepithelial neoplasia;Cervical intraepithelial neoplasia 96;235 100;239 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. In our study, the C7294T co-variation in LCR was demonstrated to associate with risk for developing >=CIN2,3. 2013 BMC cancer Discussion HPV C7294T 18 24 LCR 41 44 Cervical intraepithelial neoplasia 102 106 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. It has been demonstrated that amino acid changes of R10G/L83V can alter the ability of E6 to bind and degrade p53, induce antiapoptotic signals or alter their binding affinity with host HLA. 2013 BMC cancer Discussion HPV L83V;R10G 57;52 61;56 E6 87 89 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. It is predicted that the variation of A7515C in the C7294T co-variation can result in loss of a binding site for the human activator AP-1, while the variation of A7602G result in an addition of binding site for cellular transcription factor Oct-1. 2013 BMC cancer Discussion HPV A7515C;C7294T;A7602G 38;52;162 44;58;168 24099556 Genetic variations of E6 and long control region of human papillomavirus type 16 from patients with cervical lesion in Liaoning, China. The biological significance of the L83V variation in HPV16 remains uncertain. 2013 BMC cancer Discussion HPV L83V 35 39 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Although the physiological impact of the mixed state of multiple E1 proteins on HPV life cycle is not clear, somehow the attenuated replication phenotype of the E1 protein, as observed with Q381E, may facilitate the oncogenic progression of HPV-infected lesions, since E1 functions are frequently silenced or lost during progression to cervical cancer. 2013 PloS one Discussion HPV Q381E 190 195 E1;E1;E1 65;161;269 67;163;271 HPV infections;Cervical carcinoma 241;336 261;351 24236186 Genetic variation of human papillomavirus type 16 in individual clinical specimens revealed by deep sequencing. Since glutamine at 381 is located in the oligomerization domain of E1 (Figure 5A) and the nearby Y379F mutant completely lost replication activity (Figure 5C), possibly due to a failure to form E1-E1 oligomers, we suggest that the Q381E mutation may also affect oligomerization of E1. 2013 PloS one Discussion HPV Y379F;Q381E 97;231 102;236 E1;E1;E1;E1 67;194;197;281 69;196;199;283 24456830 Replication interference between human papillomavirus types 16 and 18 mediated by heterologous E1 helicases. In particular, the inability of the OD mutant F16E1-Y379A to inhibit HPV18 replication strongly implies that the OD-mediated interaction between HPV16 and HPV18 E1s is critical for replication interference. 2014 Virology journal Discussion HPV Y379A 52 57 E1 161 164 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C161S is the least affected mutant, but is still 3 times less stable than wild-type. 2014 PloS one Discussion HPV C161S 0 5 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. C229S virions are non-infectious at either time point. 2014 PloS one Discussion HPV C229S 0 5 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. In differentiating tissue, we found that the mutant genomes, C161S, C229S, and C379S, all produced lower viral titers at 10 and 20 days of tissue growth. 2014 PloS one Discussion HPV C161S;C229S;C379S 61;68;79 66;73;84 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. It was also found that C161S and C379S virions are more than 50% less infectious than wild-type virus at both 10 and 20 days. 2014 PloS one Discussion HPV C161S;C379S 23;33 28;38 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. The relative stabilities of C161S, C229S, and C379S virions show they are more fragile than wild-type. 2014 PloS one Discussion HPV C161S;C229S;C379S 28;35;46 33;40;51 24918586 Roles for human papillomavirus type 16 l1 cysteine residues 161, 229, and 379 in genome encapsidation and capsid stability. When comparing the infectivity of both C161S and C379 from 10- and 20-day tissue, no increase in infectivity was detected, suggesting that these mutations may have prohibited capsid maturation. 2014 PloS one Discussion HPV C161S 39 44 25096873 Maturation of the human papillomavirus 16 capsid. We also performed structural studies on an L1 Cys175 Ser mutant that does not mature. 2014 mBio Discussion HPV C175S 46 56 L1 43 45 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. However, during metaphase and anaphase, S243A remained located in the cytosol, whilst the wild type and S207A were located in the mitotic chromosomes. 2014 PloS one Discussion HPV S243A;S207A 40;104 45;109 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. However, substitution of D for S253 abrogates binding to the mitotic chromosomes, and this differs from our data showing that HPV-16 S243D could bind to Brd4 and form foci (speckles) in metaphase and anaphase chromosomes. 2014 PloS one Discussion HPV S243D 133 138 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. In addition, the S243A substituted E2 protein has a shorter half-life than the wild type, indicating that the HPV-16 E2 protein phosphorylated at serine 243 plays a role in interacting with Brd4 and this increases the protein half-life. 2014 PloS one Discussion HPV S243A 17 22 E2;E2 35;117 37;119 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. Moreover, mutation analysis showed that S243D and S243E can interact and colocalize with Brd4 in condensed metaphase and anaphase chromosomes, but S243Q and S243N cannot, because the substituted amino acids E and D are negatively charged residues that mimic the effect of constitutive phosphorylation, whilst the polar uncharged residues N and Q did not enable binding to Brd4 and mitotic chromosomes. 2014 PloS one Discussion HPV S243D;S243E;S243Q;S243N 40;50;147;157 45;55;152;162 25340539 Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes. we investigated two substituted proteins, S207A and S243A. 2014 PloS one Discussion HPV S207A;S243A 42;52 47;57 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. In the present study, we have described the construction of new genetic and FP recombinants that express the mutated non-oncogenic HPV-16 E6F47R protein to be used in combination as a preventive/therapeutic antitumor vaccine. 2015 Journal of translational medicine Discussion HPV F47R 140 144 E6 138 140 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. Our results demonstrated that: (i) the pDNAE6F47R as well as FPE6F47R recombinants can correctly express the E6F47R protein in different cell lines; (ii) the CD8+ T cell response was higher in the mice immunized with the E6 recombinants using the G1 and G2 protocols; (iii) in the preventive immunization, after challenging with TC-1* cells, tumor appearance was delayed, and the tumor volume was lower at day 23 p.c. 2015 Journal of translational medicine Discussion HPV F47R 111 115 E6;E6 109;221 111;223 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. This cannot be ascribed to a lower efficiency of the E6F47R gene expression by the FP vector, as protein expression was evident in all of the infected cells using immunofluorescence. 2015 Journal of translational medicine Discussion HPV F47R 55 59 E6 53 55 25763880 A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers. When expressed in HPV-positive cervical cancer cells, E6F47R acts as a dominant-negative mutant by counteracting the p53 degradation activity of the endogenous E6, and thus restores high p53 protein levels. 2015 Journal of translational medicine Discussion HPV F47R 56 60 E6;E6 54;160 56;162 Cervical carcinoma 31 46 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. According to the HPV variants found in this study, the amino acid substitutions circulating in Southern Mexico are: Q3E, R10G, Q14H, D25N, I27L, I27R I27T, L28V, E29K, E29Q, E29G, I52L, K68T, F69L, H78Y, L83V (the most frequent) and E113D. 2015 Virology journal Discussion HPV Q3E;R10G;I27R;I27T;E29K;E29Q;E113D;Q14H;D25N;I27L;L28V;E29G;I52L;K68T;F69L;H78Y;L83V 116;121;145;150;162;168;233;127;133;139;156;174;180;186;192;198;204 119;125;149;154;166;172;238;131;137;143;160;178;184;190;196;202;208 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. D25N, I27R and E29Q amino acid changes affect E6 T cell epitope. 2015 Virology journal Discussion HPV E29Q;D25N;I27R 15;0;6 19;4;10 E6 46 48 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. I27T amino acid change is located at the N-terminal domain of the E6 oncoprotein; K68T is located between zinc fingers of E6. 2015 Virology journal Discussion HPV I27T;K68T 0;82 4;86 E6;E6 66;122 68;124 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. L83V amino acid change display more efficient degradation of Bax and binding to E6AP, induces ubiquitination and degradation of p53, NFX1-91 and PDZ proteins. 2015 Virology journal Discussion HPV L83V 0 4 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Q14R/H78Y/L83V amino acid changes gender AA variants with increased oncogenic potential and more efficient evasion of the host's immune surveillance. 2015 Virology journal Discussion HPV H78Y;Q14R;L83V 5;0;10 9;4;14 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. The amino acid substitutions present in the HPV 16 E6 variants in descending order of association with CC were: Q14R/H78Y/L83V (AA-a variant), D25N/L83V (E-A176/G350 variant), Q14R/I27/H78Y/L83V (AA-c variant), L83V (E-G350 variant) and E29Q/L83V (E-C188/G350 variant). 2015 Virology journal Discussion HPV H78Y;L83V;Q14R;L83V;D25N;H78Y;L83V;Q14R;L83V;L83V;E29Q 117;122;112;148;143;185;190;176;211;242;237 121;126;116;152;147;189;194;180;215;246;241 E6 51 53 Cervical carcinoma 103 105 25889023 Association of human papillomavirus 16 E6 variants with cervical carcinoma and precursor lesions in women from Southern Mexico. Two of the 8 novel variants found in this study had amino acid changes not previously reported: I27T in E-C183/G350 variant and K68T in E-C306/G350 variant. 2015 Virology journal Discussion HPV I27T;K68T 96;128 100;132 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. At the E6 genomic region, five characteristic mutations, C143G, G145T, T286A, A289G, and C335T defining the African lineage were found in our study as well as it's was previously described. 2015 Infectious agents and cancer Discussion HPV C143G;G145T;T286A;A289G;C335T 57;64;71;78;89 62;69;76;83;94 E6 7 9 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. But it was also proved that the variant A647G only binds with similar affinity to that of the prototype. 2015 Infectious agents and cancer Discussion HPV A647G 40 45 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. However, E7 protein with the N29S mutation present an identical power transforming has the prototype strain, after measuring the cooperation E7/activated ras gene in rat embryo fibroblast cells. 2015 Infectious agents and cancer Discussion HPV N29S 29 33 E7;E7 9;141 11;143 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. However, some of the observed mutations are significant in the literature; in particular the two non-synonymous changes African lineage located in E6 N-terminus coding region at codon 10 and 14, which lead to amino acid changes R10T and Q14D respectively. 2015 Infectious agents and cancer Discussion HPV R10T;Q14D 228;237 232;241 E6 147 149 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. In addition, N29S is involved in binding to pRB and could alter the affinity of the E7 protein for pRB, or modification of the oncogenic potential. 2015 Infectious agents and cancer Discussion HPV N29S 13 17 E7 84 86 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. It is also reported that the amino acid change R10I in addition to other mutations described between nucleotide position 106 and 113 could lead to a low affinity for binding of E6 and degrade p53, although these findings remain controversial and poorly documented. 2015 Infectious agents and cancer Discussion HPV R10I 47 51 E6 177 179 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The D21N mutation (G622A) described in this study seems to be for the first time. 2015 Infectious agents and cancer Discussion HPV D21N;G622A 4;19 8;24 25991921 Genetic variability in E6 and E7 oncogenes of human papillomavirus Type 16 from Congolese cervical cancer isolates. The two others were non-synonymous mutations, of which a common described N29S was found in three isolates (23%). 2015 Infectious agents and cancer Discussion HPV N29S 74 78 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. It has been reported from various studies that gene variant T350G of HPV-16 was found to display more efficient degradation of Bax and strong binding to E6 binding protein. 2015 Scientific reports Discussion HPV T350G 60 65 E6 153 155 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. It is also showed that the variation T350G in HPV-16 E6 gene imparted an approximately 2 fold higher risk of viral persistence than prototype. 2015 Scientific reports Discussion HPV T350G 37 42 E6 53 55 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. On the other hand, L500F (V16) was found to be more immunogenic than the reference DNA vaccine constructs. 2015 Scientific reports Discussion HPV L500F 19 24 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. Our results showed the major variations like T379P of full length L1 gene which may play important role in the immunogenicity against HPV by affecting the binding affinity of immunogenic peptide (epitope). 2015 Scientific reports Discussion HPV T379P 45 50 L1 66 68 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. T379P (V8) variation causes the reduction of immunogenicity of epitope present in their vicinity. 2015 Scientific reports Discussion HPV T379P 0 5 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. The other variations at C6163A, G6171A, T6245C, A6314G, A6432G, C6557T, G6719A, C6852T, C6863T, C6968T G6692A and G7058A/T have also been observed in other studies from India. 2015 Scientific reports Discussion HPV C6968T;G6692A;G7058T;C6163A;G6171A;T6245C;A6314G;A6432G;C6557T;G6719A;C6852T;C6863T;G7058A 96;103;114;24;32;40;48;56;64;72;80;88;114 102;109;122;30;38;46;54;62;70;78;86;94;122 26507515 Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico &in-vivo insight to vaccine development. Variation H202D (V3) has been shown to be responsible for viral assembly. 2015 Scientific reports Discussion HPV H202D 10 15 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. In European populations, prospective studies in cervical lesions as well as case-control studies have also communicated inconsistent results regarding the involvement of the T350G polymorphism in the persistence and progression to cancer 17, 18, 33, 41. 2016 Cancer medicine Discussion HPV T350G 174 179 Cervical lesions 48 64 27654117 HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. To tackle this connection between viral genotypic diversity and cancer risk, a long-studied candidate has been the T350G(L83V) single-nucleotide polymorphism in the HPV16 genome 38, 39. 2016 Cancer medicine Discussion HPV L83V;T350G 121;115 125;120 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Finally, the detailed analysis of the effect of the two mutations in PDZO9, L391F and K392M on the binding reaction showed that there is a significant energetic coupling between F391 and M392 in PDZO9 and that this coupling is peptide dependent. 2016 Scientific reports Discussion HPV L391F;K392M 76;86 81;91 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Furthermore, the results demonstrate that PDZO9 displays an increased affinity for all peptides as compared to pWT PDZ2 due to the L391F mutation in the peptide binding site. 2016 Scientific reports Discussion HPV L391F 131 136 27694853 Improved affinity at the cost of decreased specificity: a recurring theme in PDZ-peptide interactions. Here we investigated the specificity of PDZO9 towards a panel of peptides and also the effect of the two mutations in PDZO9, L391F and K392M in the binding reaction. 2016 Scientific reports Discussion HPV L391F;K392M 125;135 130;140 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. However, lineage C harbored an additional alteration at nucleotide position 348, yielding a nonsynonymous mutation, L83V. 2016 PloS one Discussion HPV L83V 116 120 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. In addition, an association of HPV16 L83V with high-grade lesions has been shown, suggesting that it may contribute to the pathogenicity of lineage C. 2016 PloS one Discussion HPV L83V 37 41 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. It is noticeable that E7 nonsynonymous mutations (S52D, 55D, H61Y, D64N and L99R) were harbored by lineage C, but not by lineage B. 2016 PloS one Discussion HPV S52D;H61Y;D64N;L99R 50;61;67;76 54;65;71;80 E7 22 24 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. K93R (A379G) is a nonsynonymous mutation located in the E6 oncogene, which may have a specific role in carcinogenesis: it is not only the most frequently detected variation, but is also independently associated with high-grade lesions. 2016 PloS one Discussion HPV K93R;A379G 0;6 4;11 E6 56 58 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. L83V have been reported not only in HPV52, but also in HPV16 and HPV33. 2016 PloS one Discussion HPV L83V 0 4 27977741 Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. Lineage B-specific mutations included the most frequently detected nonsynonymous mutation K93R (A379G) in E6, while lineage C-specific mutations included an E6 nonsynonymous mutation (L83V, concurrent mutations of C348G and G350T) and five E7 nonsynonymous mutations, S52D (concurrent mutations of A706G and G707A), Y55D (T727G), H61Y (C733T), D64N (G742A) and L99R (T848G)). 2016 PloS one Discussion HPV K93R;A379G;L83V;C348G;G350T;S52D;A706G;G707A;Y55D;T727G;H61Y;C733T;D64N;G742A;L99R;T848G 90;96;184;214;224;268;298;308;316;322;330;336;344;350;361;367 94;101;188;219;229;272;303;313;320;327;334;341;348;355;365;372 E6;E6;E7 106;157;240 108;159;242 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. For example, the score of HPV-58 E6 B-cell epitope 81-96YSLYGDTLEQTLKKCL was 0.90, because of the mutation D86E, the score of epitope 81-96YSLYGETLEQTLNKCL decreased to 0.86; the HPV-58 E7 predicted epitope 77-85VRTLQQLLM disappeared because of the mutation V77A. 2017 PloS one Discussion HPV D86E;V77A 107;258 111;262 E6;E7 33;186 35;188 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. HPV-33 falls next to HPV-58 in the phylogenetic tree; and remarkably, the positive sites K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6, they may have evolutionary significance in making HPV-33 and HPV-58 adaptive to their environments. 2017 PloS one Discussion HPV K93N 89 93 E6 149 151 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. In the present study, G542T (R145I, a positive mutation) in HPV-33 E6 and G543A (R145K, a positive mutation) were found at residues 145-149; G658 (S29, a positive mutation) in HPV-33 E7 was found at residues 21-29, G632T (T20I, a positive mutation) in HPV-58 E7 was found beside residues 21-29; C755A (T61N) in HPV-58 E7 was found at residues involved in Zn binding for E7 protein. 2017 PloS one Discussion HPV G542T;R145I;G543A;R145K;G632T;T20I;C755A;T61N 22;29;74;81;215;222;295;302 27;34;79;86;220;226;300;306 E6;E7;E7;E7;E7 67;183;259;318;370 69;185;261;320;372 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. In the present study, variations other than HPV-33 E6 K93N, HPV-33 E7 Q97L and HPV-58 E7 T20I were observed in sites belonging to ideal B-cell and/or MHC predicted epitopes. 2017 PloS one Discussion HPV K93N;Q97L;T20I 54;70;89 58;74;93 E6;E7;E7 51;67;86 53;69;88 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. Of all these variations in the present study, the five newly-reported mutations have been only found in southwest China until now: G329C (S74T) and G542T (R145I, a positive variation) for HPV-33 E6, D658C (S29T, a positive variation) for HPV-33 E7 as well as A259G and T395C for HPV-58 E6. 2017 PloS one Discussion HPV G329C;S74T;G542T;R145I;D658C;S29T;A259G;T395C 131;138;148;155;199;206;259;269 136;142;153;160;204;210;264;274 E6;E6;E7 195;286;245 197;288;247 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. Some variations, like HPV-58 E6 R145K, occurred at the sites belonging to both B-cell and MHC epitopes; Amino acids change may influence the epitopes, and then the immune recognition of HPV-infected cells. 2017 PloS one Discussion HPV R145K 32 37 E6 29 31 HPV infections 186 198 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. The HPV-58 E6 mutations T20I and G63S have been reported to increase the risk of developing cervical cancer; interestingly, in the present study, we found that these two mutations were positively selected. 2017 PloS one Discussion HPV T20I;G63S 24;33 28;37 E6 11 13 Cervical carcinoma 92 107 28141822 E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China. The most common mutations observed in HPV-33 E6 were A231C (K35N, 42/216, a positive mutation) and A387C (K93N, 42/216, a positive mutation); in HPV-33 E7 were G658C (S29T, 36/216, a positive mutation) and C706A (A45E, 27/216); in HPV-58 E6 were C307T (237/405) and A388C (K93N 111/405); while the most common non-synonymous mutations in HPV-58 E7 were T744G (319/405) and G761A (G63D, 163/405, a positive mutation). 2017 PloS one Discussion HPV A231C;K35N;A387C;K93N;G658C;S29T;C706A;A45E;C307T;A388C;K93N;T744G;G761A;G63D 53;60;99;106;160;167;206;213;246;266;273;353;373;380 58;64;104;110;165;171;211;217;251;271;277;358;378;384 E6;E6;E7;E7 45;238;152;345 47;240;154;347 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 All of Iranian cervical cancer showed variation T234G in the form of silent mutation, thus having no effect on protein. 2017 Asian Pacific journal of cancer prevention Discussion HPV T234G 48 53 Cervical carcinoma 15 30 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Also, the amino acid substitutions S63F (57.66 %), and R66W (72.39 %) were positioned at the C-terminal domain of the E7 oncoprotein due to the nucleotide changes C188T, and R196W respectively. 2017 Asian Pacific journal of cancer prevention Discussion HPV S63F;R66W;C188T;R196W 35;55;163;174 39;59;168;179 E7 118 120 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Boumba et al., (2015) explained two common silent variations and described mutations N29S among isolates from Asia, and Africa (23%). 2017 Asian Pacific journal of cancer prevention Discussion HPV N29S 85 89 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Moreover, they founded the D21N mutation (G622A). 2017 Asian Pacific journal of cancer prevention Discussion HPV D21N;G622A 27;42 31;47 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Our results explain the amino acid substitutions N29S (10.42 %) was located at the N-terminal domain of the E7 oncoprotein because of the nucleotide changes A86G. 2017 Asian Pacific journal of cancer prevention Discussion HPV N29S;A86G 49;157 53;161 E7 108 110 28441787 Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363 Tsakogiannis et al., recognized seven new amino acid substitutions H2Y, M12K, A42T, M84I, G85S, G85D, and T86I within the E7 gene in cervical samples (Tsakogiannis et al., 2013). 2017 Asian Pacific journal of cancer prevention Discussion HPV H2Y;M12K;A42T;M84I;G85S;G85D;T86I 67;72;78;84;90;96;106 70;76;82;88;94;100;110 E7 122 124 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. In addition, the nucleotide changes G7193T and G7521A, which accounted for 100% of the infections in our study, were the most prevalent. 2017 PloS one Discussion HPV G7193T;G7521A 36;47 42;53 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The G7521A variant was located at the binding site of the transcriptional repressor SOX9, a potential tumor suppressor in cervical cancer, and suppressesing cervical tumor growth through transactivating p21WAF1/CIP1. 2017 PloS one Discussion HPV G7521A 4 10 Cervical carcinoma;Cervical carcinoma 122;157 137;171 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The presence of A7730C variants in LCR, which was further shown to be a potential binding site for PHOX2A, a transcription factor involving in cell proliferation and migration in lung cancer, showed a high mutation frequency in cervical cancer. 2017 PloS one Discussion HPV A7730C 16 22 LCR 35 38 Lung cancer;Cervical carcinoma 179;228 190;243 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The variation of G7193T was predicted at the binding site for the cellular transcription factor FOXA1, which has been reported as a pioneer transcription factor that regulates the progression of cancer in the breast, liver, prostate, lung, and endometrium. 2017 PloS one Discussion HPV G7193T 17 23 28767682 Genetic variability and functional implication of the long control region in HPV-16 variants in Southwest China. The variations of C7394T and C7395T were predicted within the binding site for Ets transcription factor 1, which has been demonstrated to play roles in the complex biological control of tumor progression. 2017 PloS one Discussion HPV C7394T;C7395T 18;29 24;35 28794033 Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants. For example, E7 aa 63 is under positive selection, with 3 different amino acid changes at the same codon: G63S is shared by the A3 and B1 sublineages, G63D is conserved in the A2 and D2 sublineage, and G63H is unique to the D1 sublineage. 2017 Journal of virology Discussion HPV G63S;G63D;G63H 106;151;202 110;155;206 E7 13 15 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. M424I and M430I amino acid substitutions are located in the H4 helice whereas the Ser insertion is located in the H2 helice. 2017 Bioinformation Discussion HPV M424I;M430I 0;10 5;15 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. Of particular interest, all the isolates analyzed differ from the reference sequence by the insertion of an ATC codon at position 6903 and deletion of GAT at positions 6951/2/3. 2017 Bioinformation Discussion HPV ins 6903ATC 92 134 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. Of particular interest, fine-mapping of the epitope footprint showed that the five non-synonymous changes of amino acids residues, including the ATC insertion and GAT deletion, are localized in the H2 and H4 helices and H-I and B-C loop regions T389P amino acid substitution is located in the H-1 loop, identified as an immunogenetic region of L1 capsid and believed to contribute towards cross-neutralising antibody. 2017 Bioinformation Discussion HPV T389P 245 250 L1 344 346 28959092 Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco. There's evidence that among the 5 non-synonymous mutations obtained in this study, 4 don't affect the immunogenic site of L1 and therefore don't interfere with the binding of monoclonal antibodies targeting HPV 16 and only the T389P amino acid substitution present in 51.4% of cases was associated with potential interaction to monoclonal antibodies induced vaccines. 2017 Bioinformation Discussion HPV T389P 227 232 L1 122 124 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. Additionally, the most common substitutions in the HPV-58 LCR were C7265G, C7266T and A7793G. 2018 Virology journal Discussion HPV C7265G;C7266T;A7793G 67;75;86 73;81;92 LCR 58 61 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. And the most common non-synonymous substitutions in the HPV-58 E6 and E7 were A388C (K35 N) and T803C (V77A), respectively. 2018 Virology journal Discussion HPV A388C;K35N;T803C;V77A 78;85;96;103 83;90;101;107 E6;E7 63;70 65;72 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. In addition, G63S/D (a positively selected site) affected the MHC class-I binding peptide, and V77A, the most common non-synonymous substitution in the HPV-58 E7, made the predicted MHC class-II binding peptide VRTLQQLLM (E7, 77-85) disappear. 2018 Virology journal Discussion HPV G63D;G63S;V77A 13;13;95 19;19;99 E7;E7 159;222 161;224 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The non-synonymous substitution T20I potentially affected the MHC class-I and class-II binding peptides, probably leading to the loss of the CD8+ cytotoxic T cell or CD4+ helper T cell responses, respectively. 2018 Virology journal Discussion HPV T20I 32 36 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The nucleotide substitution C321T in the HPV-58 E6, leading to the amino acid change (S71F) was the novel variation detected in this study when compared with those from 2010 to 2011. 2018 Virology journal Discussion HPV C321T;S71F 28;86 33;90 E6 48 50 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. The occurrence of C632T and G760A in the HPV-58 E7, which were identified in our study and resulted in the amino acid changes including T20I and G63S, respectively, has been implied to be linked to an increased risk for cervical cancer. 2018 Virology journal Discussion HPV G63S;C632T;G760A;T20I 145;18;28;136 149;23;33;140 E7 48 50 Cervical carcinoma 220 235 29695285 The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China. V77A in the E7 was observed in the sequences encoding the alpha-helix. 2018 Virology journal Discussion HPV V77A 0 4 E7 12 14 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Consistent with the downregulation of A2-variant LCRs by A7879G in HeLa cells, we also found that the A1-sublineage LCR12 is repressed by A7874C, which affects a nucleotide only 5-bp away from A7879. 2018 Scientific reports Discussion HPV A7879G;A7874C 57;138 63;144 LCR;LCR 49;116 53;119 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Given the association of A1-viruses with CIN2/3 and cervical cancer, and of C7732G with HSIL, it is tempting to speculate that the stronger activity of these LCRs in PHK is reflective of their higher oncogenicity in epidemiological studies. 2018 Scientific reports Discussion HPV C7732G 76 82 LCR 158 162 Cervical carcinoma;Squamous intraepithelial lesions;Cervical intraepithelial neoplasia 52;88;41 67;92;45 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In contrast, the 79del/C7537A and A7879G variations were found to have a substantial effect on the EP when introduced individually into LCR-PT, but to antagonize each other within LCR6. 2018 Scientific reports Discussion HPV C7537A;A7879G 23;34 29;40 LCR;LCR 136;180 139;183 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. In these cells, the activities of the variant EPs were more homogeneous and closer to that of the prototype, with the only exception being the 50% weaker activity of LCR12 (Fig.聽2C) caused by the A7874C variation (Fig.聽5B). 2018 Scientific reports Discussion HPV A7874C 196 202 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Interestingly, A7874C lies within E2-binding site 2 (E2BS2) of the LCR and was shown here to increase the activity and binding of E2 at this site in vivo. 2018 Scientific reports Discussion HPV A7874C 15 21 LCR;E2;E2 67;34;130 70;36;132 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Interestingly, the LCRs with the highest activities in PHK (white or lighter shades of red in Fig.聽7) were the A1-sublineage LCR-PT and LCR12, and the two A2-variants LCR6 and LCR14 which contain the C7732G variation. 2018 Scientific reports Discussion HPV C7732G 200 206 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Our characterization of HPV33 LCR variants was motivated by the previous associations of A1-sublineage variants with cervical intraepithelial neoplasia of grades 2-3 (CIN2/3) and cervical cancer, and the results of our own studies, which revealed that the LCR variations C7732G and 79del are linked to HSIL and persistent infections, respectively. 2018 Scientific reports Discussion HPV C7732G;79del 271;282 277;287 LCR;LCR 30;256 33;259 Cervical intraepithelial neoplasia;Cervical carcinoma;Squamous intraepithelial lesions;Cervical intraepithelial neoplasia 117;179;302;167 165;194;306;171 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Our results also indicate that C7732G contributes to the functional heterogeneity of A2-sublinage variants, with the two LCR variants containing this variation (LCR6 and LCR14) showing comparable activities as A1-variant LCRs, and the one lacking it (LCR5) behaving more like a B-lineage variant in PHK. 2018 Scientific reports Discussion HPV C7732G 31 37 LCR;LCR;LCR;LCR;LCR 121;161;170;221;251 124;164;173;225;254 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. The weaker effect of C7732G in HeLa cells, and of the partial (79del) or complete deletion (2xdel) of the duplicated 79-bp region, was also apparent when these variations were introduced into the prototype LCR. 2018 Scientific reports Discussion HPV C7732G;79del 21;63 27;68 LCR 206 209 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. This effect of A7874C is easily explained by the fact that it improves the fit of E2BS2 to the high-affinity E2-binding consensus sequence ACCGNNNNCGGT (variant position underlined). 2018 Scientific reports Discussion HPV A7874C 15 21 E2 109 111 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. This suggestion is further supported by our findings that the duplication of the 79-bp region in A1-variants, and the C7732G variation found in some A2-variants, are the two changes with the greatest stimulatory effect on the EP in PHK. 2018 Scientific reports Discussion HPV C7732G 118 124 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Thus, the comparable activities of the prototype and variants LCRs in HeLa cells can be explained by the fact that some variations like C7732G and 79del only have a minor effect and by the observation that the more active variations antagonize each other as seen for 79del/C7537A and A7879G in A2-sublineage LCRs. 2018 Scientific reports Discussion HPV C7732G;C7537A;A7879G;79del 136;273;284;147 142;279;290;152 LCR;LCR 62;308 66;312 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Thus, we suggest that the presence or absence of C7732G should be taken into consideration in future epidemiological studies as it underlies the functional heterogeneity of A2-variants and, thus, may explain why this sublineage has not been associated with neoplasia. 2018 Scientific reports Discussion HPV C7732G 49 55 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. Thus, while the stimulation of the EP by the 79-bp duplication could contribute to the oncogenicity of A1 variants, the lower transcriptional activity of A2- and B-variants caused by 79del may increase their persistence. 2018 Scientific reports Discussion HPV 79del 183 188 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. We also revealed the positive and negative regulation of the EP by the 79del/C7537A, A7874C and A7879G variations in HeLa cells and the increased E2-binding affinity that A7874C confers to E2BS2. 2018 Scientific reports Discussion HPV C7537A;A7874C;A7879G;A7874C 77;85;96;171 83;91;102;177 E2 146 148 30301935 Naturally Occurring Variations Modulate the Activity of the HPV33 Early Promoter and its Affinity for the E2 Transcription Factor. We have highlighted the stimulation of the EP in PHK by the 79-bp duplication unique to the oncogenic A1-variants and by the HSIL-associated variation C7732G, which contributes to the heterogeneity of the A2-sublineage. 2018 Scientific reports Discussion HPV C7732G 151 157 Squamous intraepithelial lesions 125 129 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. However, the E350G (or L83V) intra-variant primarily found in our study was not associated with the development of CC in all European populations. 2018 The Indian journal of medical research Discussion HPV E350G;L83V 13;23 18;27 Cervical carcinoma 115 117 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. In addition, functional studies demonstrated that the E350G E6 variant has biological advantages over the E-P (European-Prototype). 2018 The Indian journal of medical research Discussion HPV E350G 54 59 E6 60 62 30425223 High frequency of HPV16 European variant E350G among Mexican women from Sinaloa. The higher association of AA and E350G variants and cancer risk may be linked to a better ability to evade the host immune system and/or an increased oncogenic potential associated with intrinsic biological properties of viral proteins. 2018 The Indian journal of medical research Discussion HPV E350G 33 38 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Although naturally occurring T20I and G63S variations always co-exist,27 we generated artificial mutants in order to delineate their functional roles independent of each other. 2019 Journal of cellular and molecular medicine Discussion HPV T20I;G63S 29;38 33;42 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. As HPV58 accounts for 20% of CINI cases, more intensive cancer surveillance is recommended for carriers of the E7 V1 (T20I/G63S) variant and prototype, for early detection of the disease. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 123;118 127;122 E7 111 113 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. From the biochemical point of view, substitution of threonine to isoleucine at amino acid residue 20 changes a polar residue to a non-polar one, while substitution of glycine to serine at residue 63 does the reverse. 2019 Journal of cellular and molecular medicine Discussion HPV T20I;G63S 52;167 100;198 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. In summary, our studies successfully identified the HPV58 E7 V1 (T20I/G63S) variant and prototype as possessing higher carcinogenic potential than other variants in our experimental settings. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 70;65 74;69 E7 58 60 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. In this connection, we have previously described the identification of several HPV58 E7 variants from clinical specimen; and among them, T20I/G63S (V1) was significantly associated with a higher risk for cervical cancer.25, 27 Herein, we sought to substantiate our earlier epidemiological observations by determining the biological significance of the HPV58 E7 variants, particularly V1 (T20I/G63S). 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I;G63S;T20I 142;137;393;388 146;141;397;392 E7;E7 85;358 87;360 Cervical carcinoma 204 219 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Interestingly, it is worth noting that the HPV58 E7 prototype, which is the very first HPV58 clone obtained from a Japanese woman suffering from invasive cervical carcinoma28 also showed a comparable colony-forming ability in soft agar colony formation assay and possessed similar pRb-degrading ability as the V1 (T20I/G63S) variant, indicating that they both possess higher oncogenic potential than the other studied HPV58 E7 variants (V2 and V3). 2019 Journal of cellular and molecular medicine Discussion HPV T20I;G63S 314;319 318;323 E7;E7 49;424 51;426 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Interestingly, our previous epidemiological results found that the HPV58 E7 V1 (T20I/G63S) variant was more frequently detected in East Asia (34%) than other areas of the world (4.9%).27 Taken together with our current results which demonstrated a potential higher oncogenic role of the HPV58 E7 V1 variant, our study implicates the more common circulation of an oncogenic HPV58 E7 variant among the Asian population, which might partly explain the higher disease burden associated with HPV58 in East Asia. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 85;80 89;84 E7;E7;E7 73;293;379 75;295;381 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Moreover, we have focused on E7 variations in this study, as our previous studies showed that sequence variations of HPV58 mainly reside in E7, while E6 is relatively conserved among individuals.27 Given that both E6 and E7 are major HPV oncoproteins, it is anticipated that co-expression of E6 prototype with the E7 variants could give a more complete picture of HPV oncogenesis and might reveal more additional oncogenic properties that contribute to the increased cervical cancer risk of the E7 V1 (T20I/G63S) variant. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 507;502 511;506 E6;E6;E6;E7;E7;E7;E7;E7 150;214;292;29;140;221;314;495 152;216;294;31;142;223;316;497 Cervical carcinoma 467 482 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Our findings suggested that among the three most common circulating HPV58 E7 variants, the V1 (T20I/G63S) variant had a stronger immortalising/transforming ability and exerted higher oncogenicity through the pRb pathway. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 100;95 104;99 E7 74 76 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. Our results showed that both T20I and G63S appeared to contribute to the observed oncogenic phenotypes and their combined effects were statistically stronger than that of individual variants. 2019 Journal of cellular and molecular medicine Discussion HPV T20I;G63S 29;38 33;42 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. The higher oncogenic potential of the E7 V1 (T20I/G63S) variant and prototype suggests that their carriers may present with a more malignant phenotype and a possible poorer disease outcome. 2019 Journal of cellular and molecular medicine Discussion HPV G63S;T20I 50;45 54;49 E7 38 40 30575267 Oncogenic comparison of human papillomavirus type 58 E7 variants. We showed that while all tested E7 proteins demonstrated similar intracellular localisation and half-life, the V1 (T20I/G63S) variant showed an increased immortalising and transforming ability with a higher pRb-degrading power than the other two common circulating HPV58 E7 variants (V2 and V3). 2019 Journal of cellular and molecular medicine Discussion HPV T20I;G63S 115;120 119;124 E7;E7 32;271 34;273 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Examination of the sequence around T7791C revealed a putative binding site for the transcription factor C/EBPbeta, which we termed BS1. 2019 Scientific reports Discussion HPV T7791C 35 41 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In conclusion, we have described here a naturally-occurring variation, T7791C, which enhances the transcriptional activity of the HPV33 EP by disrupting an inhibitory C/EBPbeta binding site. 2019 Scientific reports Discussion HPV T7791C 71 77 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. In vitro experiments confirmed the binding of C/EBPbeta-homodimers to BS1 and the deleterious effect of T7791C on this interaction. 2019 Scientific reports Discussion HPV T7791C 104 110 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. It is possible that T7791C is less efficient than mBS1 at preventing the binding of C/EBPbeta to BS1 because it affects only one of the two half-sites which comprise this site, in contrast to the quadruple mBS1 mutation which affects both. 2019 Scientific reports Discussion HPV T7791C 20 26 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Rather, the higher activity of LCR10 in PHK could be ascribed to the fact that it lacks the G18A variation, which is present in the other B-lineage LCRs and represses their transcriptional activity. 2019 Scientific reports Discussion HPV G18A 92 96 LCR;LCR 31;148 34;152 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Remarkably, the G18A variation that lowers transcription from all B-lineage LCRs other than LCR10 also lies in this AT-rich region. 2019 Scientific reports Discussion HPV G18A 16 20 LCR;LCR 76;92 80;95 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The EP activity of LCR4, 7, 8 and 9, but not of LCR10, is also further reduced by the G18A variation which exerts its greatest inhibitory effect in PHK. 2019 Scientific reports Discussion HPV G18A 86 90 LCR;LCR 19;48 22;51 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The second point that can be made from the heatmap is that all B-lineage LCRs and LCR10 revertants behaved similarly in the three cancer cell lines (C33A, HeLa and U2OS) although small differences were noted in the magnitude of EP stimulation by the T7791C variation. 2019 Scientific reports Discussion HPV T7791C 250 256 LCR;LCR 73;82 77;85 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The stimulatory effect of T7791C and mBS1 were comparable in C33A, HeLa and U2OS cells, consistent with the idea that they affect the same regulatory element. 2019 Scientific reports Discussion HPV T7791C 26 32 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. The T7791C variation was found to be responsible for the higher activity of LCR10 in C33A, HeLa and U2OS cells, but not in PHK where it repressed the EP in combination with T7365C and C7531T. 2019 Scientific reports Discussion HPV T7791C;T7365C;C7531T 4;173;184 10;179;190 LCR 76 79 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. This raises the possibility that G18A represses the EP by altering the activity of the AT-region and/or its functional interplay with BS1 if the latter functions as a switch region, although this remains to be tested. 2019 Scientific reports Discussion HPV G18A 33 37 30911096 Characterization of an HPV33 natural variant with enhanced transcriptional activity suggests a role for C/EBPbeta in the regulation of the viral early promoter. Unlike mBS1, however, T7791C failed to activate the EP in PHK for reasons that remain unknown. 2019 Scientific reports Discussion HPV T7791C 22 28 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Accounting for 100% of all infections, G7191T and G7518A mutations, were predicted by Xi et al. 2019 Cancer cell international Discussion HPV G7191T;G7518A 39;50 45;56 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Amino acids 21-34 of the E7 protein form a region that combines with tumor suppressor protein Rb, and the A647G mutation may block the physiological function of Rb, thereby maintaining long-term infection with HPV. 2019 Cancer cell international Discussion HPV A647G 106 111 E7 25 27 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Among 19 samples with polymorphism in E6 T178G or E7 A647G, 18 cases (94.7%) had two loci changed at the same time, which was consistent with the studies of Ding. 2019 Cancer cell international Discussion HPV T178G;A647G 41;53 46;58 E6;E7 38;50 40;52 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. However, it has been reported that joint mutation of E6 T350G and E7 A647G may be Chinese specific. 2019 Cancer cell international Discussion HPV T350G;A647G 56;69 61;74 E6;E7 53;66 55;68 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In addition, Eur viruses have been divided into a few small branches, such as E-T350 (Ep), E-G350 (T350G), E-G131 (A131G) and E-C109 (T109C). 2019 Cancer cell international Discussion HPV T350G;A131G;T109C 99;115;134 104;120;139 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In addition, most of the mutations in A647G occur in the As sub-lineage. 2019 Cancer cell international Discussion HPV A647G 38 43 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In addition, three cases showed the E7 T846C mutation in association with the combined mutation of the above two loci. 2019 Cancer cell international Discussion HPV T846C 39 44 E7 36 38 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In contrast to the above report, 36 cases of T350G polymorphism were found in this study, and there was no polymorphism of the joint site mentioned above. 2019 Cancer cell international Discussion HPV T350G 45 50 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. In this study, a total of 13 polymorphic sites were identified in 75 HPV16 E6 sequences, and T350G (36/75, 48%) and T178G (19/75, 25.3%) comprised the majority of 11 missense mutations, this result is consistent with that of Cai et al. 2019 Cancer cell international Discussion HPV T350G;T178G 93;116 98;121 E6 75 77 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. It was found that A645C (L28F) has an incidence of 19% in cervical cancer tissues from Korean women and that this mutation also occurs in Italy and Japan. 2019 Cancer cell international Discussion HPV A645C;L28F 18;25 23;29 Cervical carcinoma 58 73 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. Studies have shown that HPV16 E6 T350G (L83V) variants are prevalent in high cervical lesions in Moroccan women and are closely related to the progression of cervical cancer. 2019 Cancer cell international Discussion HPV T350G;L83V 33;40 38;44 E6 30 32 Cervical lesions;Cervical carcinoma 77;158 93;173 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. T178G (D25E) variations are mainly distributed in the Asian population (such as China, Japan and South Korea); the mutation can interact with Human Lymphocyte Antigen (HLA) gene polymorphisms and promote the development of cervical cancer. 2019 Cancer cell international Discussion HPV T178G;D25E 0;7 5;11 Cervical carcinoma 223 238 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. The frequency of A7727C mutation is relatively high. 2019 Cancer cell international Discussion HPV A7727C 17 23 30930693 Genetic variations in E6, E7 and the long control region of human papillomavirus type 16 among patients with cervical lesions in Xinjiang, China. The results of this study show that the common polymorphism site of the E7 gene is A647G, which is similar to the results of Yang et al. 2019 Cancer cell international Discussion HPV A647G 83 88 E7 72 74 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Among the mutations with statistically significant differences in distribution between the case and control groups in the current study, the T921C (T19T), T933A (A23A), T1014G (D50E), A1041G (L59L), C1096G (Q78E), G1163A (G100E) and T1200C (A112A) mutations are located in the N-terminal region; the T1366A (C168S), C1426G (Q188E), T1486C (L208L), T1522A (S220T), C1624T (L154L), A1668G (A268A) and C1744A (L294M) mutations are located in the DNA-binding domain; and the C2041T (L393L), G2160A (R432R), G2220C (E452D), T2232C (F456F), C2237G (T458S), G2249A (R462K), C2262T (G466G), C2287T (L475L), A2547G (P561P), T2586C (S574S), A2608C (R582R), T2631A (P589P) and G2650A (E596K) mutations are located in the C-terminal enzymatic domain. 2019 International journal of medical sciences Discussion HPV T921C;T19T;T933A;A23A;T1014G;D50E;A1041G;L59L;C1096G;Q78E;G1163A;G100E;T1200C;A112A;T1366A;C168S;C1426G;Q188E;T1486C;L208L;T1522A;S220T;C1624T;L154L;A1668G;A268A;C1744A;L294M;C2041T;L393L;G2160A;R432R;G2220C;E452D;T2232C;F456F;C2237G;T458S;G2249A;R462K;C2262T;G466G;C2287T;L475L;A2547G;P561P;T2586C;S574S;A2608C;R582R;T2631A;P589P;G2650A;E596K 141;148;155;162;169;177;184;192;199;207;214;222;233;241;300;308;316;324;332;340;348;356;364;372;380;388;399;407;471;479;487;495;503;511;519;527;535;543;551;559;567;575;583;591;599;607;615;623;631;639;647;655;666;674 146;152;160;166;175;181;190;196;205;211;220;227;239;246;306;313;322;329;338;345;354;361;370;377;386;393;405;412;477;484;493;500;509;516;525;532;541;548;557;564;573;580;589;596;605;612;621;628;637;644;653;660;672;679 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Furthermore, our results showed that the T921C (T19T), T933A (A23A), T1014G (D50E), A1041G (L59L), C1096G (Q78E), G1163A (G100E), T1200C (A112A), T1366A (C168S), T1407G (S181R), C1426G (Q188E), T1486C (L208L), T1522A (S220T), C1624T (L154L), C1744A (L294M), C2041T (L393L), G2220C (E452D), T2232C (F456F), C2237G (T458S), G2249A (R462K), C2262T (G466G), C2287T (L475L), T2567G (I568S), T2586C (S574S), A2608C (R582R) and T2631A (P589P) mutations were also found only in the case group, however, these mutations were not found in the study by Tsakogiannis et al., but they found the G2073A (K403K), T2169C (D435D), T2189C (I442T), A2453T (N530I), C2454T (N530N) and A2587T (R575W) mutations in the high-grade dysplasia cases, which were not found in our study. 2019 International journal of medical sciences Discussion HPV T921C;T19T;T933A;A23A;T1014G;D50E;A1041G;L59L;C1096G;Q78E;G1163A;G100E;T1200C;A112A;T1366A;C168S;T1407G;S181R;C1426G;Q188E;T1486C;L208L;T1522A;S220T;C1624T;L154L;C1744A;L294M;C2041T;L393L;G2220C;E452D;T2232C;F456F;C2237G;T458S;G2249A;R462K;C2262T;G466G;C2287T;L475L;T2567G;I568S;T2586C;S574S;A2608C;R582R;T2631A;P589P;G2073A;K403K;T2169C;D435D;T2189C;I442T;A2453T;N530I;C2454T;N530N;A2587T;R575W 41;48;55;62;69;77;84;92;99;107;114;122;130;138;146;154;162;170;178;186;194;202;210;218;226;234;242;250;258;266;274;282;290;298;306;314;322;330;338;346;354;362;370;378;386;394;402;410;421;429;582;590;598;606;614;622;630;638;646;654;665;673 46;52;60;66;75;81;90;96;105;111;120;127;136;143;152;159;168;175;184;191;200;207;216;223;232;239;248;255;264;271;280;287;296;303;312;319;328;335;344;351;360;367;376;383;392;399;408;415;427;434;588;595;604;611;620;627;636;643;652;659;671;678 High-grade dysplasia 697 717 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Furthermore, we found that T933A (A23A), T1014G (D50E), and G2160A (R432R) showed a significant difference in distribution between the case and control groups for the A4 (As) sub-lineage and that T2232C (F456F), G2337A (M491I), and A2547G(P561P) had a statistically significant difference in distribution between the case group and control group for the A1-A3 (EUR) sub-lineage; thus, these mutations could play different roles in the A4 (As) sub-lineage and A1-A3 (EUR) sub-lineage. 2019 International journal of medical sciences Discussion HPV T933A;A23A;T1014G;D50E;G2160A;R432R;T2232C;F456F;G2337A;M491I;A2547G;P561P 27;34;41;49;60;68;196;204;212;220;232;239 32;38;47;53;66;73;202;209;218;225;238;244 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. In the current study, we also found that A1668G (A268A) and G2650A (E596K) occurred only in the case group, and this finding suggested these two mutations may play key roles in the carcinogenesis of cervical cancer. 2019 International journal of medical sciences Discussion HPV A1668G;A268A;G2650A;E596K 41;49;60;68 47;54;66;73 Cervical carcinoma 199 214 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. Moreover, we found that the T933A (A23A), T1014G (D50E), and G2160A (R432R) mutations in the A4 (As) sub-lineage and the T2232C (F456F), G2337A (M491I), and A2547G (P561P) mutations in the A1-A3 (EUR) sub-lineage played important roles in the development of cervical cancer. 2019 International journal of medical sciences Discussion HPV T933A;A23A;T1014G;D50E;G2160A;R432R;T2232C;F456F;G2337A;M491I;A2547G;P561P 28;35;42;50;61;69;121;129;137;145;157;165 33;39;48;54;67;74;127;134;143;150;163;170 Cervical carcinoma 258 273 31341418 Human Papillomavirus Type 16 E1 Mutations Associated with Cervical Cancer in a Han Chinese Population. reported that the A1668G (A268A), G2073A (K403K), T2169C (D435D), T2189C (I442T), A2453T (N530I), C2454T (N530N), A2587T (R575W) and G2650A (E596K) mutations of HPV16 E1 were identified only in high-grade dysplasia cases in a Greek population. 2019 International journal of medical sciences Discussion HPV A1668G;A268A;G2073A;K403K;T2169C;D435D;T2189C;I442T;A2453T;N530I;C2454T;N530N;A2587T;R575W;G2650A;E596K 18;26;34;42;50;58;66;74;82;90;98;106;114;122;133;141 24;31;40;47;56;63;72;79;88;95;104;111;120;127;139;146 E1 167 169 High-grade dysplasia 194 214 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. Although C7763T and A7841G were not located in the enhancer region, these two sites are close to the enhancer region and the binding sites of NF1 and YY1, respectively. 2020 International journal of medical sciences Discussion HPV C7763T;A7841G 9;20 15;26 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. C7729A is located in the enhancer region and proximal to the binding site of YY1, NF1, Tef-1 and Octamer factor-1 transcription factors. 2020 International journal of medical sciences Discussion HPV C7729A 0 6 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. found that G7428A and C7873G in the A4 (As) variant, which are proximal to the p97 promoter, showed higher transcriptional activity than other A4 (As) and A1-A3 (EUR) variants. 2020 International journal of medical sciences Discussion HPV G7428A;C7873G 11;22 17;28 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In addition, we also found that HPV16 LCR variations (A7167G, A7173C, C7176T, C7200T, T7269C, C7286A, C7729A, C7763T, A7841G, G7867A and T24C) were statistically significant between the case group and control groups. 2020 International journal of medical sciences Discussion HPV A7167G;A7173C;C7176T;C7200T;T7269C;C7286A;C7729A;C7763T;A7841G;G7867A;T24C 54;62;70;78;86;94;102;110;118;126;137 60;68;76;84;92;100;108;116;124;132;141 LCR 38 41 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In the current study, G7867A variation, which is likely one of the binding sites of E2 protein, was only found in the control group. 2020 International journal of medical sciences Discussion HPV G7867A 22 28 E2 84 86 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In the current study, our results also showed that the distribution of C7873G was significantly different between the case and control groups in the A4 (As) variant (P=0.039). 2020 International journal of medical sciences Discussion HPV C7873G 71 77 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In the current study, the distributions of A7167G and A7173C were located in the 5' segment of the LCR of HPV16, and our results showed that the distributions of the two variations were significantly different between the case and control groups (P=0.007 and P=0.008, respectively). 2020 International journal of medical sciences Discussion HPV A7167G;A7173C 43;54 49;60 LCR 99 102 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In the current study, we found that the distribution of T24C showed a significant difference between the control and case groups (P=0.043), which indicated that this variation could induce dysregulation of E6 and E7 gene expression through changing the cellular and viral transcription factor binding sites. 2020 International journal of medical sciences Discussion HPV T24C 56 60 E6;E7 206;213 208;215 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. In the current study, we found that the frequencies of C7729A, C7763T and A7841G, which are located in the enhancer region, showed significant differences between the case and control groups (P=0.033, 0.017, and 0.022, respectively). 2020 International journal of medical sciences Discussion HPV C7729A;C7763T;A7841G 55;63;74 61;69;80 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. Moreover, the distribution of C7873G variation was significantly different between the case and control groups in the A4 (As) variant, and no variations were significantly different between the case and control groups in the A1-A3 (EUR) variant. 2020 International journal of medical sciences Discussion HPV C7873G 30 36 32308546 Association of Human Papillomavirus Type 16 Long Control Region Variations with Cervical Cancer in a Han Chinese Population. reported that A7167G and A7173C are located in the binding site of the transcription factor AP1 and FOXA1. 2020 International journal of medical sciences Discussion HPV A7167G;A7173C 14;25 20;31 32448303 Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea : Korean HPV18 variants and clinical manifestation. In our population, 6 substitutions, namely, C287G in E6 and G5503A, C5701G, C6460G, C6625G, and C6842G in L1, were found in all HPV18 variants. 2020 Virology journal Discussion HPV C287G;G5503A;C5701G;C6460G;C6625G;C6842G 44;60;68;76;84;96 49;66;74;82;90;102 E6;L1 53;106 55;108 32448303 Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea : Korean HPV18 variants and clinical manifestation. Our data on the genetic diversity of the HPV18 variants in Korea show two nonsynonymous substitutions in the loop structures, L64M within the BC loop (of BRM34) and T149N within the DE loop (of BRM20, BRM31 ~ 36). 2020 Virology journal Discussion HPV L64M;T149N 126;165 130;170 Breast neoplasms 142 144 32503989 Rational design of a multi-valent human papillomavirus vaccine by capsomere-hybrid co-assembly of virus-like particles. (2) A 1:1 molar ratio of the involved C175A and C428A L1 proteins is favorable for hybrid-assembly. 2020 Nature communications Discussion HPV C175A;C428A 38;48 43;53 L1 54 56 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. A6562G is located 11 bases from the beginning of the SPF10 target region, possibly causing less efficient SPF10 primer binding. 2020 Journal of clinical microbiology Discussion HPV A6562G 0 6 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. Although no phylogenetic distinction was found between L1 sequences of SPF10-detected and -missed HPV-59 variants, more missed HPV-59 variants carried the A6562G SNP. 2020 Journal of clinical microbiology Discussion HPV A6562G 155 161 L1 55 57 32907991 Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates. Likewise, GP5+/6+-impaired primer hybridization on HPV-52 was found due to a synonymous T6764C substitution. 2020 Journal of clinical microbiology Discussion HPV T6764C 88 94 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. Except for mutation S383G, which occur in surface loop of BDG-163 (HI-loop) this may be considered as new HPV-45 variant (Figure 3). 2020 Asian Pacific journal of cancer prevention Discussion HPV S383G 20 25 32986347 Phylogeny and In Silico Structure Analysis of Major Capsid Protein (L1) Human Papillomavirus 45 from Indonesian Isolates. However, most of the amino acid mutations might not affect antibody neutralization since the polarity of altered amino acids are similar to mutation I329T. 2020 Asian Pacific journal of cancer prevention Discussion HPV I329T 149 154 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Among the E2 variants found in this study, D153Y seems to be less stably expressed in cells, which likely leads to the failure of this variant to regulate viral replication and transcription. 2020 Frontiers in microbiology Discussion HPV D153Y 43 48 E2 10 12 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Consistent with the important role in DNA interaction suggested from structural inspection, R302T completely lost binding activity to the viral origin DNA containing three E2-recognition sites, and this defect nicely explains the inability of R302T to regulate viral origin-dependent replication and early promoter-driven transcription. 2020 Frontiers in microbiology Discussion HPV R302T;R302T 92;243 97;248 E2 172 174 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Indeed, we found that of six E1/E2 variants tested, three (E1 M207I, E2 D153Y, and E2 R302T) had a reduced ability to regulate viral replication or transcription. 2020 Frontiers in microbiology Discussion HPV M207I;D153Y;R302T 62;72;86 67;77;91 E1;E1;E2;E2;E2 29;59;32;69;83 31;61;34;71;85 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Our finding that the two intra-host variants of E2 are defective for viral replication/transcription is consistent with the prevailing consensus on the role of E2 in HPV-induced carcinogenesis, implying the possibility that cells expressing D153Y and R302T had been positively selected for their contribution to cervical cancer development through enhanced expression of E6/E7. 2020 Frontiers in microbiology Discussion HPV D153Y;R302T 241;251 246;256 E2;E2;E6;E7 48;160;371;374 50;162;373;376 Cervical carcinoma 312 327 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Our previous study reported another within-host E1 variant, Q381E, which was present at a relatively high abundance (5.42%) in one ICC sample. 2020 Frontiers in microbiology Discussion HPV Q381E 60 65 E1 48 50 Cervical carcinoma 131 134 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Regarding E1 variants, M207I showed a reduced ability to support viral origin-dependent replication, although it was expressed at a similar level to the prototype E1 and retained the ability to interact with E2. 2020 Frontiers in microbiology Discussion HPV M207I 23 28 E1;E1;E2 10;163;208 12;165;210 33324377 High Levels of Within-Host Variations of Human Papillomavirus 16 E1/E2 Genes in Invasive Cervical Cancer. Such replication defect may be attributed to some change in DNA interaction during DNA unwinding by M207I because this residue is included in the DNA-binding domain of E1. 2020 Frontiers in microbiology Discussion HPV M207I 100 105 E1 168 170 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. The most common non-synonymous substitution in the HPV-58 E6 was A278G (K93R), and E7 was only one sample with non-synonymous. 2021 Virology journal Discussion HPV A278G;K93R 65;72 70;76 E6;E7 58;83 60;85 33941222 The genetic variability, phylogeny and functional significance of E6, E7 and LCR in human papillomavirus type 52 isolates in Sichuan, China. The two non-synonymous mutations of E6, E3Q and K93R, had almost no effect on the high-affinity epitopes of T and B cell; E7 non-synonymous mutations were found in only one sample, and these non-synonymous mutations enhanced its affinity with B cell. 2021 Virology journal Discussion HPV E3Q;K93R 40;48 43;52 E6;E7 36;122 38;124 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Additionally, HPV16 E6 H85Y and E120D belong to the A2 sublineage in this study but are not associated with cervical cancer. 2021 BMC cancer Discussion HPV E120D;H85Y 32;23 37;27 E6 20 22 Cervical carcinoma 108 123 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. In our study, we did not find that HPV16 E6 T350G (L90V) was associated with cervical cancer risk, which is in good agreement with previous data in China. 2021 BMC cancer Discussion HPV T350G;L90V 44;51 49;55 E6 41 43 Cervical carcinoma 77 92 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. In particular, we found that the three most common variations in HPV16 isolates were the T178G (D32E) in E6 (64.1%) and A647G (N29S) and T846C in E7 (65.4 and 64.4%, respectively), and these three nucleotide substitutions are apparently linked because of their simultaneous occurrence in 96.4% of A4 (Asian) variants in this study. 2021 BMC cancer Discussion HPV T178G;D32E;A647G;N29S;T846C 89;96;120;127;137 94;100;125;131;142 E6;E7 105;146 107;148 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. It has been confirmed that the non-synonymous substitution A647G(N29S) may block the physiological function of Rb, thereby maintaining long-term infection of HPV and increasing the likelihood of persistent viral infection and cervical cancer progression. 2021 BMC cancer Discussion HPV A647G;N29S 59;65 64;69 Cervical carcinoma 226 241 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. It has been reported that the prevalence of both non-synonymous substitutions D32E and N29S is much higher in Asia (65.5% in China, 68.0% in Korea, 44.2% in Japan and 73.9% in Thailand) than in Europe (2%), North America (3%), and Africa (0%). 2021 BMC cancer Discussion HPV D32E;N29S 78;87 82;91 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. Our results showed that the oncogenicity of E6 D32E and E7 N29S variations was associated with the development of cervical cancer. 2021 BMC cancer Discussion HPV D32E;N29S 47;59 51;63 E6;E7 44;56 46;58 Cervical carcinoma 114 129 34217247 Association of cervical carcinogenesis risk with HPV16 E6 and E7 variants in the Taizhou area, China. T350G (L90V) has been shown to be associated with the progression of cervical lesions. 2021 BMC cancer Discussion HPV T350G;L90V 0;7 5;11 Cervical lesions 69 85 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. Among them, some mutations, such as D614G and N501Y of SARS-CoV-2, T350G of HBV, and C659T of HVP-16, have been proved to play an important role in the viruses, indicating the reliability and effectiveness of AutoVEM2. 2021 Computational and structural biotechnology journal Discussion HPV T350G 67 72 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. For HPV-16, the T350G (83L>V) mutation we detected is the most common mutation on the E6 gene of HPV-16. 2021 Computational and structural biotechnology journal Discussion HPV T350G;L83V 16;23 21;28 E6 86 88 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. It is reported that T350G variants can down-regulate the expression of E-cadherin, which is an adhesion protein that acts cell-cell adhesion. 2021 Computational and structural biotechnology journal Discussion HPV T350G 20 25 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. Several studies have shown that the T350G mutant may cause persistent virus infection and further increase cancer risk. 2021 Computational and structural biotechnology journal Discussion HPV T350G 36 41 34512928 AutoVEM2: A flexible automated tool to analyze candidate key mutations and epidemic trends for virus. The C3410T mutation we detected, on the E2 gene of HPV-16, is also one of the common mutations of HPV-16. 2021 Computational and structural biotechnology journal Discussion HPV C3410T 4 10 E2 40 42 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. A model to explain the S23A phenotype is that the E2-TopBP1 interaction locates the viral genome to sites on chromatin that allow replication of the viral genome during mitosis or to sites that will promote viral replication during the subsequent S phase following mitosis. 2021 mBio Discussion HPV S23A 23 27 E2 50 52 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Additionally, E2-WT increases the levels of TopBP1 during mitosis, while E2-S23A cannot. 2021 mBio Discussion HPV S23A 76 80 E2;E2 14;73 16;75 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Cell cycle analysis demonstrates that E2-WT levels are increased during mitosis, while E2-S23A levels are not, agreeing with the staining patterns observed. 2021 mBio Discussion HPV S23A 90 94 E2;E2 38;87 40;89 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. CK2 phosphorylation of bovine papillomavirus 1 (BPV1) E2 on 301 regulates the stability of this protein, although this residue is not conserved on HPV16 E2 and both E2-WT and E2-S23A are expressed at relatively equivalent levels in both U2OS and N/Tert-1 cells. 2021 mBio Discussion HPV S23A 178 182 E2;E2;E2;E2 54;153;165;175 56;155;167;177 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. E2-WT cannot interact with TopBP1 in vitro, while E2-S23D can. 2021 mBio Discussion HPV S23D 53 57 E2;E2 0;50 2;52 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Finally, we demonstrate that there is a dramatic loss of E2 expression in the S23A cells compared with the wild-type cells. 2021 mBio Discussion HPV S23A 78 82 E2 57 59 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. For E2-S23A, there was a reproducible reduction in E2 staining on mitotic chromatin although it was located on the mitotic chromatin, and also recruited TopBP1 to the mitotic chromatin. 2021 mBio Discussion HPV S23A 7 11 E2;E2 4;51 6;53 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Future work will focus on understanding the mechanism of the aberrant life cycle promoted by the S23A mutant. 2021 mBio Discussion HPV S23A 97 101 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. However, due to the failure to detect gammaH2AX (as a surrogate marker for viral replication), we favor that E2 degradation and a failure to replicate causes the phenotypes we observe with the S23A genome-containing cells. 2021 mBio Discussion HPV S23A 193 197 E2 109 111 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. However, integration of a subset of viral genomes with the S23A mutant would potentially explain the more transformed phenotypes of the S23A cells, as integration is associated with a more aggressive HPV-positive tumor. 2021 mBio Discussion HPV S23A;S23A 59;136 63;140 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. However, this is not reflective of any aspect of the HPV16 life cycle, and to determine the effect of the S23A mutation on this process, we submitted cells to organotypic rafting. 2021 mBio Discussion HPV S23A 106 110 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. In transient replication and transcription assays, the E2-S23A function is similar to E2-WT. 2021 mBio Discussion HPV S23A 58 62 E2;E2 55;86 57;88 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Introduction of the S23A mutation into the HPV16 genome resulted in a delay in immortalization, although the resulting cells that grew out retained episomal viral genomes. 2021 mBio Discussion HPV S23A 20 24 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. It is also possible that the S23A mutant is somehow promoting integration of the viral genome into the host due to an aberrant viral replication function resulting in a loss of E2 expression. 2021 mBio Discussion HPV S23A 29 33 E2 177 179 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. It is of course possible that multiple aberrant functions of E2 S23A could contribute to the aberrant life cycle. 2021 mBio Discussion HPV S23A 64 68 E2 61 63 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Morphologically, the S23A cells looked more dysplastic than the wild-type cells with a "thinner" epithelium; there was an increase in the number of koilocytes and whorls as well as detection of epithelial invasion into the collagen/fibroblast stroma. 2021 mBio Discussion HPV S23A 21 25 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The dramatic effects of the S23A mutation during organotypic rafting compared with cells cultured on plastic could be related to the interaction of the HPV16-positive cells with the collagen/fibroblast stroma and/or to the differentiation status of the cells. 2021 mBio Discussion HPV S23A 28 32 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. The S23A cells were also less differentiated and more proliferative than wild-type cells, again supporting the idea of an aberrant life cycle and increased dysplasia with the S23A mutant genome cells. 2021 mBio Discussion HPV S23A;S23A 4;175 8;179 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Therefore, E2-WT and E2-S23A have distinct phenotypes during mitosis. 2021 mBio Discussion HPV S23A 24 28 E2;E2 11;21 13;23 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. Therefore, we investigated the interaction of E2-WT and E2-S23A with mitotic chromatin. 2021 mBio Discussion HPV S23A 59 63 E2;E2 46;56 48;58 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. These cells were grown on plastic with no feeder cells, and the S23A mutation had no effect on cell proliferation when the cells were grown in this manner. 2021 mBio Discussion HPV S23A 64 68 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. This resulted in several striking phenotypes, indicating an epithelial-stroma interaction that preferentially affects the HPV16 S23A-containing cells; there is a complex interaction between HPV-infected cells and the stroma. 2021 mBio Discussion HPV S23A 128 132 HPV infections 190 202 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. To demonstrate phosphorylation of S23 in vivo, we generated a phospho-specific antibody (pS23-Ab) which recognizes E2-WT, including during mitosis, but not E2-S23A. 2021 mBio Discussion HPV S23A 159 163 E2;E2 115;156 117;158 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. We demonstrate that there is a failure of viral replication with the S23A mutant resulting in a reduction in viral genomes in the mid-to-upper layers of the differentiated raft. 2021 mBio Discussion HPV S23A 69 73 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. We propose that there is an additional factor that mediates the interaction of E2-S23A with mitotic chromatin, and this is under active investigation. 2021 mBio Discussion HPV S23A 82 86 E2 79 81 34544280 CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle. While such inhibitors would abolish viral production and therefore potentially block viral transmission, they could also promote the more transformed phenotypes observed with the S23A genomes. 2021 mBio Discussion HPV S23A 179 183 34696378 Phylogenomic Analysis of Human Papillomavirus Type 31 and Cervical Carcinogenesis: A Study of 2093 Viral Genomes. A functional study has shown that a mutant version of the HPV6 E7 with the H23Y SNP has a higher affinity pRb binding site than the HPV6 wild type, leading to transactivation of the host's cell cycle genes via the E2F transcription factor. 2021 Viruses Discussion HPV H23Y 75 79 E7 63 65 34696378 Phylogenomic Analysis of Human Papillomavirus Type 31 and Cervical Carcinogenesis: A Study of 2093 Viral Genomes. We show that the H23Y (SNP at position 626) in E7, is more prevalent in the A2 and B2 sublineages and creates an identical 21-DLYCYE-26 pRb binding site to HPV16 E7, which suggests a shared carcinogenic component for both HPV31 A2/B2 and HPV16 given its higher pRb affinity. 2021 Viruses Discussion HPV H23Y 17 21 E7;E7 47;162 49;164 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. By contrast, in this study we demonstrate the presence of non-synonymous variants (E5:3979C, A4042G) and non-coding variation (7577T) in LCR region in conjunction with E6:350G as risk alleles, highlighting the polygenic aspect of viral contribution to disease. 2022 Translational oncology Discussion HPV A4042G 93 99 LCR;E5;E6 137;83;168 140;85;170 34717279 Predominance of genomically defined A lineage of HPV16 over D lineage in Indian patients from eastern India with squamous cell carcinoma of the cervix in association with distinct oncogenic phenotypes. Further, irrespective of the HPV16 lineages, our study also reflected the lack of genomic variations within the E7 gene among the CaCx cases, as opposed to a single variation (C790T) among the control samples. 2022 Translational oncology Discussion HPV C790T 176 181 E7 112 114 Cervical carcinoma 130 134 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. According to the calculation, the positive selection site of HPV-16 E6 was D32E (128/250); HPV-33 E6 were K35N (42/216), K93N (42/216), R145I (33/216); HPV-52 E6 was K93R (252/288); HPV-58 E6 were K93N (111/405), R145K (16/405); These positive selection sites all belong to its high frequency non-synonymous mutation, suggesting that these positive selection sites, which contribute to the adaptation of alpha-9 HPV E6, have been widely spread. 2022 Virology journal Discussion HPV D32E;K35N;K93N;R145I;K93R;K93N;R145K 75;106;121;136;166;197;213 79;110;125;141;170;201;218 E6;E6;E6;E6;E6 68;98;159;189;416 70;100;161;191;418 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K93N and R145I of HPV-58 E6 reduced the affinity of excellent HLA-I antigen epitopes. 2022 Virology journal Discussion HPV K93N;R145I 0;9 4;14 E6 25 27 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. K93N of HPV-33 E6, K93R of HPV-52 E6, and K93N of HPV-58 E6 are located at the outer edge of E6 protein and near the zinc granule. 2022 Virology journal Discussion HPV K93N;K93R;K93N 0;19;42 4;23;46 E6;E6;E6;E6 15;34;57;93 17;36;59;95 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. Positive selection sites K35N and K93N of HPV-33 E6 are close to the zinc granules, while R145I located in the E6 PDZ binding domain; K35N and R145I made 35-43KPLQRSEVY for HLA-C*03:02 and 141-149RSRRRETAL for HLA-C*01:02 disappear respectively, K93N changed the epitope number and affinity; Above three positive selection sites of HPV-33 E6 located in E6 protein active region, affect the protein conformation, function and reduced the immunogenicity of the peptide containing the above sites to a certain amount. 2022 Virology journal Discussion HPV K35N;K35N;K93N;R145I;R145I;K93N 25;134;34;90;143;246 29;138;38;95;148;250 E6;E6;E6;E6 49;111;339;353 51;113;341;355 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. Positive selection sites of HPV-16 E6 D32E, D32N located in protein outer edge and next to the zinc granules; 6 HLA-II epitopes disappeared due to D32E/D32N; In Japan, D32E has been confirmed to be associated with the development of cervical cancer; T-cell antigen epitopes affinity reduced due to D32E, D32N, that may lead to the persistent infection of virus and promote the development of cervical cancer. 2022 Virology journal Discussion HPV D32E;D32N;D32E;D32N;D32E;D32E;D32N 38;44;147;152;168;298;304 42;48;151;156;172;302;308 E6 35 37 Cervical carcinoma;Cervical carcinoma 233;392 248;407 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. The N86H, R145I of HPV-33 E6 and D86E, R145K of HPV-58 E6 occurred in the same positions; K93N of HPV-33 E6, K93R of HPV-52 E6 and K93N of HPV-58 E6 all located in the 93rd of the E6 protein; those amino acid substitutions located in protein active region, can cause the E6 terminal and the trend of the carboxyl end structure disorder. 2022 Virology journal Discussion HPV N86H;R145I;D86E;R145K;K93N;K93R;K93N 4;10;33;39;90;109;131 8;15;37;44;94;113;135 E6;E6;E6;E6;E6;E6;E6 26;55;105;124;146;180;271 28;57;107;126;148;182;273 35057815 The polymorphism analysis and epitope predicted of Alphapapillomavirus 9 E6 in Sichuan, China. The positive selection site K93R of HPV-52 E6 changed the epitope number and decreased the affinity of excellent epitopes. 2022 Virology journal Discussion HPV K93R 28 32 E6 43 45 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. However, two of them were found in only one sample (Y365F and F458L) and may have occurred by PCR amplification. 2022 BMC infectious diseases Discussion HPV Y365F;F458L 52;62 57;67 35086475 Genetic diversity in L1 ORF of human papillomavirus in women with cervical cancer with and without human immunodeficiency virus in Botswana and Kenya. Variants identified based on the sequencing of the L1 region are; HPV-16 (L441P, S343P), HPV-18 (S424P), HPV-45 (Q366H, Y365F), belonged to the HPV HR-HPV group and HPV-84 (F458L) for the LR-HPV group. 2022 BMC infectious diseases Discussion HPV Q366H;L441P;S343P;S424P;Y365F;F458L 113;74;81;97;120;173 118;79;86;102;125;178 L1 51 53 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. A similar process with synthetic 9-mers spanning the wild-type E6 at aa 55 (aa 47 to 55 through aa 55 to 63, with 8 amino acids overlapping for 9 peptides in total) could be used for the E6(R55K) mutation. 2022 mBio Discussion HPV R55K 190 194 E6;E6 63;187 65;189 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. For example, for E7 the N53S mutation may prevent our ability to identify a native peptide covering that mutation. 2022 mBio Discussion HPV N53S 24 28 E7 17 19 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Furthermore, the N53S mutation on the E7 protein does not impact the HLA-A2-restricted E7-specific CTL epitopes (aa 11 to 20, aa 82 to 90, and aa 86 to 93) that were described previously. 2022 mBio Discussion HPV N53S 17 21 E7;E7 38;87 40;89 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Here, we described that the N53S mutation of HPV16 E7 and the (R55K)(delK75) mutations of HPV16 E6 eliminated the presentation of E6 and E7 through murine MHC-I molecules. 2022 mBio Discussion HPV N53S;R55K 28;63 32;67 E6;E6;E7;E7 96;130;51;137 98;132;53;139 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Meaning, although the N53S mutation in the E7 mutant and the dual R55K and delK75 mutations in the E6 mutant allow us to eliminate the immunodominant murine epitopes, we may have erroneously deleted a CTL epitope that would have otherwise elicited an HLA-restricted E6/E7-specific CD8+ T cell response. 2022 mBio Discussion HPV N53S;R55K;delK75 22;66;75 26;70;81 E6;E6;E7;E7 99;266;43;269 101;268;45;271 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. One potential explanation is that these point mutations [HPV16 E6(R55K)(delK75) and HPV16 E7(N53S)] are not in the regions of E6 and E7 that are critical for the interaction of key cellular proteins, such as p53 or Rb, which are important for the carcinogenesis of HPV-associated malignancies. 2022 mBio Discussion HPV R55K;N53S 66;93 70;97 E6;E6;E7;E7 63;126;90;133 65;128;92;135 HPV-associated cancer 265 292 35089069 Development of a Spontaneous HPV16 E6/E7-Expressing Head and Neck Squamous Cell Carcinoma in HLA-A2 Transgenic Mice. Synthetic overlapping 9-mer peptides covering the mutated E7(N53S) or E6(R55K) regions can be used to challenge the mice. 2022 mBio Discussion HPV N53S;R55K 61;73 65;77 E6;E7 70;58 72;60 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. A combination of changes in A7483C, G7487A, G7519A, C7667T, C7687A, A7727C, C7762T, and C7784T led to an increase in the transcription activity of these variants; all of these changes were observed in the studied HPV-16 LCR. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV A7483C;G7487A;G7519A;C7667T;C7687A;A7727C;C7762T;C7784T 28;36;44;52;60;68;76;88 34;42;50;58;66;74;82;94 LCR 220 223 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. Among mutations described here, A7483C, G7487A, G7519A, C7667T, C7687A, A7727C G7824A, C7762T, and C7784T mutations were identified in D1 isolates. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV G7824A;A7483C;G7487A;G7519A;C7667T;C7687A;A7727C;C7762T;C7784T 79;32;40;48;56;64;72;87;99 85;38;46;54;62;70;78;93;105 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. Among these variants, G7519A, C7687A, and G7824A were identified in our samples. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV G7519A;C7687A;G7824A 22;30;42 28;36;48 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. For instance, in the HPV 16 LCR, an A7727C change was a distinctive characteristic of the increased activity of p97 in D variants. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV A7727C 36 42 LCR 28 31 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. reported that some mutations in the HPV 16 LCR, especially in YY1 binding sites, such as G7519A (the most common mutation in YY1 binding site), A7634C, C7687A, T7712G, C7790T, G7824A, A7837C, T7741, and C7762T, led to increased p97 activity by three to six folds. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV G7519A;A7634C;C7687A;T7712G;C7790T;G7824A;A7837C;C7762T 89;144;152;160;168;176;184;203 95;150;158;166;174;182;190;209 LCR 43 46 35126798 Genetic Diversity of HPV 16 and HPV 18 Based on Partial Long Control Region in Iranian Women. showed that nucleotide changes in A7483C, G7487A, G7519A, A7505G, C7667T, C7687A, A7727C, T7741G, C7762T, and C7784T affected the ori function of HPV, leading to an increase in ori-dependent transcription and replication activities, increased activities of promoters (by 2-3.5 folds), and consequently, the increased expression of E6 and E7 oncogenes. 2022 The Canadian journal of infectious diseases & medical microbiology Discussion HPV A7727C;A7483C;G7487A;G7519A;A7505G;C7667T;C7687A;T7741G;C7762T;C7784T 82;34;42;50;58;66;74;90;98;110 88;40;48;56;64;72;80;96;104;116 E6;E7 331;338 333;340 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. In addition, there were 17 cases of E6 gene mutations at 178th nucleotides (T178G) belonging to the Asian standard strain. 2022 Cancer cell international Discussion HPV T178G 76 81 E6 36 38 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. Our study found seven HPV16 E6 T295G and T350G nucleotide co-mutations, which may serve as a variant of the HPV16 European mutant strain. 2022 Cancer cell international Discussion HPV T295G;T350G 31;41 36;46 E6 28 30 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. Studies have shown that HPV16 E6-T350G mutations in Moroccan women are prevalent in high-grade cervical lesions and are closely related to the progression of cervical cancer. 2022 Cancer cell international Discussion HPV T350G 33 38 E6 30 32 Cervical carcinoma;Cervical lesions 158;95 173;111 35193568 HPV16 E6 gene polymorphisms and the functions of the mutation site in cervical cancer among Uygur ethnic and Han nationality women in Xinjiang, China. There were 65 cases of E6 gene mutations at 350 nucleotides (T350G) with a mutation frequency of 63.64%, and corresponding amino acid change of leucine valine (L83V). 2022 Cancer cell international Discussion HPV T350G;L83V 61;162 66;166 E6 23 25 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Although the D32E mutation in E6 protein did not change the B-cell epitopes, the gene variation altered the other gene profiles. 2022 Virology journal Discussion HPV D32E 13 17 E6 30 32 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Compared with the HPV52 reference sequence (NC 001,592), the K93R was the only one non-synonymous mutation. 2022 Virology journal Discussion HPV K93R 61 65 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Compared with the reference (NC001526), four non-synonymous mutations were found in HPV16 L1 protein, including H76Q (1/27), N181T (7/27), E240D (1/27) and T266A (27/27). 2022 Virology journal Discussion HPV E240D;H76Q;N181T;T266A 139;112;125;156 144;116;130;161 L1 90 92 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. For HPV16, the most frequent non-synonymous mutations found in E6 gene was D32E (7/18). 2022 Virology journal Discussion HPV D32E 75 79 E6 63 65 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. It was reported that the S63F mutation was more frequent in women with carcinoma cancer. 2022 Virology journal Discussion HPV S63F 25 29 Cervical carcinoma 71 87 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. It was suggested that the D32E amino mutation had a significant correlation with the persistent HPV16 infection in females. 2022 Virology journal Discussion HPV D32E 26 30 HPV infections 96 111 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Synonymous mutations in L1 gene, including G6196A (19/27, 70.4%), A5803C (18/27, 66.7%) and T5683C (8/27, 29.6%), had also been reported in Sichuan province. 2022 Virology journal Discussion HPV G6196A;A5803C;T5683C 43;66;92 49;72;98 L1 24 26 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The amino mutations N181T (7/27) and T266A (27/27) were also found in other provinces, such as Shanghai and Sichuan province. 2022 Virology journal Discussion HPV N181T;T266A 20;37 25;42 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The K93R mutation was also observed in other HPV52 isolates in China. 2022 Virology journal Discussion HPV K93R 4 8 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The reason was assumed that the S63F variation had an influence on the E7 epitopes and caused viral persistence and cervical cancer. 2022 Virology journal Discussion HPV S63F 32 36 E7 71 73 Cervical carcinoma 116 131 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The S63F was the most prevalent non-synonymous mutations in E7 genes. 2022 Virology journal Discussion HPV S63F 4 8 E7 60 62 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. The synonymous mutation C751T and A801G were observed in other report and the roles need be further studied. 2022 Virology journal Discussion HPV C751T;A801G 24;34 29;39 35246180 Prevalence and distribution of human papillomavirus (HPV) in Luoyang city of Henan province during 2015-2021 and the genetic variability of HPV16 and 52. Though the K93R mutation did not increase the cell immortalization ability of HPV52, a higher colony formation and greater cell migration ability was observed when compared to HPV52 prototype. 2022 Virology journal Discussion HPV K93R 11 15